Description :
From Genome Similarity Track
Location :
Scaffold_109:98933- 100602
Sequence
1669 bases(100 bases per row)
ATTGCTTCTTCTCCTGGTTACACTTTTTTCCGACTGACACACTTTTTCCTCCGTATTCTATAAGGAAACTTTCTAACAGATCCTTTCCCGACTGACAAAA
GGATCGGCTTATCTGGCTGTGTTAGCTCCGCCCGGGGCCTGTAAGTAGACCAAGCATCCTTCCATATTTGGTGCTTGATCGTGTAGGAATGCAGAGTTGA
CCTTGTTGATCCAGCTCCTGGCGCGATCTTTGTCTTTCTCTCGTTCTATAAAATATATTCAGTCTGAAATTGCGGACATCAAAATACGCTATGTTTTGAA
ACCTCAAATTGGTGCAGTCTCCGCAGCTGCTACGAATTGTCGCCTAATATCATCGTTCTTCATTCTTTGGGATCGCAGTTGTTGATCGAGTTTGACGCAA
TCCAGCGGATTACATGTCTACAACCAGGATACACCTCTTTAAAGTGATCGTGGGCATCGCCTATATACTCGCAATCATGTGGTCTTGATCCTGCTAATAC
TACTTCTACTTGGCCGCTTCGAAGTAAGACTGTAGCTGGCTTGATCGCGTTGGGTTCGTATTCAGAACAGTAGGTCTGATCGTCGGTCGCACTTTGGTCT
TGATATGAAACATTCGTTCCCTTATGGGTGCCGCACCACTACGTCCAAGAGGCATTTCTTGGATATGAATCGATTTTTTGAGTATATTTCTTATTCCTCC
GATGCGTACTTTATTTATTCCGTGTGGTATCTTTTTGGAATTTCGGTAGTCTCGTCATCTGCTGATCCGTGTGACGTCCGATGCAGGAAATCAATTTTTT
TAAACTACAATCGTCTTGCGTGATTCACTTGATCATGATCACATTCCAGCAGCGTATTCGTATGGAACGCTTTGTCGCTGAATTCAGCGTCCTCAAGTAG
CTACATTAGAGAAAGGATCGCATCCAACTGATTTTTATTATGCGCAGGAGCTTACAACAAACCTTGTAGCAATCAAATTAGCTTCATTTTCAAGATATGT
TTAACACATGATCACTTTACAGTAATTTCCTAACTCTTTCCAGTGAAAAAACCGTTCGAGTTGATCTGTTTACCATTCTTTCGTATCGGACCCGCGATCA
GCCGACTTCTCTCTTAATAGCCGTGATCGGATCCAGATGCCTCTATCTCACCTGAGACGGCTTAAAATCTTTGTCTTTGACCTGGTGGGGGTGGGTACGG
ATTAAATTCTTTCAGATTTTAATGTTGAATTTTTACCAGATCTCTTTTGCGACACGATCTGCAAGGGTCATCGAACGGACCTCGGGAGAGGTTCGAGGTT
TGTCTCCCAGATTGAGCTATCGATATTCCCCCTTAACTTTTTCCCATAAAAGTCCCTCTTCACACTCTGAAGATCTGGATATCCTTCGTCTTCACACGTC
ATCAACGATCTCTCTTCCGCTGACACTTCGATTTCAGATTTGGTCTTGATCTTGACACCTTTTTTGTGGGACTCACATCAAAATATAGAGTCACCAGAAG
ATCCAGGAACTCACACGATTTTGGTGGAGGGAGTTCAAAAAATTCTTATACGATCCCGACCCTTCACTGGCGCCCAGAGGACCGTCTAACAGAGAGGTAC
TGCGATTTCGTGCTGTAAACTTTTCACATCTTGTGTACCCATTAATAAGGCGGGTCGCTCTCATCTTGT