Description :
From Genome Similarity Track
Location :
Scaffold_44:98930- 101450
Sequence
2520 bases(100 bases per row)
GCGAGGAGCGATTCGCAGCGCAGTCCTGGGAGTCCTTGCGCGAGTCTGGTAATCCAGTGTACGAGACCGTCCGCGAATACGCGGACGTCTTTCCCGATAA
GATTCCAGCCGAACTGCCTGCCGATCGATGCGTCCGCCACGAGATCGATCTCGCGCCCGGTTCGAAGTACTGTGTGACGCGGCAGTGGCCGCTGCCGCGA
GACCAAGTCAAGGCCATCGACGACTTCTTCGAGAATCGCCGTAAAGCGGGTCACGTGCGTGAGAGTGTCTCTCCACATTCGAGCCCAACGTTCTGTGTGA
AGAAGGCCACAAGTGGATGGCGCATCGCTCATGCCTTTAACAAGTTGAATTATGCGACCATCCCCGCGCAAACCCCGATTCGGAAGGACATGGTGCTCGA
CACCATGGCGGGCAGTGTCGTCTTCAGCGCCATCGACTTGACCGATGGATTCTATCAGATCTTGATGAGACCGAGCGACATCCCCCTGACAGCGGTCAGC
ACCCCCAGCGGAATGCTCTGGGAGTGGCTTGTGATGCCACAAGGCTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTCTCCCATGTGATGCGTCCGC
TTCGAGACTTCGCACCGAGCTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGTGGTCTCAGCGCGATAGAAGTCCACTTGAGGCACTTAAAACA
GGTCTTTCAAGTGATGCGCGAGAACAAGTTGTACGCGAACCTGAAGAAGTGTATCTTCTGCGCGCCGGAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAG
GACAGCGTTCGCGCCGACCCGGAGAAGGTGTCCTCTATCTGCGCATGGCCGACACCAAAGAACCCCACTGAGTTGCGTTAGTGGTTGGGGCTAGCAAATT
ATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGCCCCTCTCATCACTCCTGAAGAAAGATGCCACATGGGTCTGGTCACCCGCGCACCAAGC
CGCCTTCGACTCAGTGAAGAAGAGCCTTGCTGAGGCGCCGATCCTAGCTCTTCCCGACGACTCGAAACCATATCACGTCGTTTGCGACGCGAGCGACTTT
GCCATCGGCTGTGCGCTGATGCAGTTTGACGACGAAGGACGTGAATGGGTCGTCATCTATCAGTCTCGACAGATGAAGCCAGCGGAGCGCAACTATCCTG
TCCACGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATCAAATTCATAGTGTACTTACTCGGCGAGCAAACCTTCGCAGTTATACCGATCACGCATCG
CTGAGGACAGCGATGAAGAGCCCTCATCTTTCCCAGCGAATGGCTCGCTGGTTGTCGTTCTTCTCCGAGTATAATTTCGTGGTTCACTACAGACCCGGCA
AGAACAACATCCTTGCAGATGCTCTGTCTCGTCGTCCAGATTACGACCCACGCGATTCGCTGGGTCGACAACCGCTGCATGATGAAGACGACGAAGACAA
CTGTGCTATGTGCTTGGCGTCGGGATTGAACCTGACGAGCGTGTCTTCAGAAACCCCACTCCGCGACGAAATCCGGACTGCGTATGAATTCGATCCGGTC
TATTCGAGTATTCTGGAACATCTCCGCTCGCCCAGTGAAAAGACACTGAGTGCTTTGTCCCGCTCCACACGCCATCAGATCGATAGGTATCGGATTGAAG
ACGGGCTGTTAACGTACAGCATCGATCGCTTCGATGCTTTGCGTGTAGTGGTTCCCAACGATCCTGACTTGCGCTCGCGGATCATCCACGAGTTCCACGA
TATCCCTCTTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCAGTGTCGCGCGGCTTTTACTGGCCCCACATGTATAAGTGAGTGCGCAAGTGGGTG
AGGACCTGCGAGATCTGCCAACGCGTGAAACCGTCCGCGTCATCGCAGGCTCCCCTGCGTCCCTTACCAGTGGCCACCGAGGCATGGCGCTCGGTGTCGA
TGGACTTCGTCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACAGGTTCAGCAAGATGGTTCACCTCATCCCGGTCCC
GGATACGATCACCGCGGCCGATACCGCGGTACACTTCGTGGATGCAGTCTTCCGTCATCATGGCATGCCCGAGTCCATTGTTTCGGACCGCGATCCGCGG
TTCACGTCTGCTTTCTGGACGAAGCTCTTCGAGCTATCAGGGACAAAGCTGCTGATGTCGACGGCCGCTCATCCGGAGACGGATGGCCAAACCGAGCGAG
TTAATCGCGTCCTTGAGGACGTACTTCGCAGCTATGCGACGTCGTTTACGAGCTGGAGCTCGTTCCTTCCGGTTGCTGAGCTCGCGCTGAACAACGCGGT
TCACGCGTCGACTGGCTTGACTCCTTTCTTCGTCAACAACGCTCGGCACCCTCGCGTTCCAGCTCTCCTCGCCGTGGGCCGTCCCACGGCGCCGTGTGGC
TCCACTCTGGGTGGGGGTGA