Description :
From Genome Similarity Track
Location :
Scaffold_9:98928- 101217
Sequence
2289 bases(100 bases per row)
ACTGTGCGGTTGTTCGTACTGCTGTTACTATATCGGTTGGTATTAATGTTATTTTATTTTTACTACTGCTATCACTATAGTTGTTGGTACTGCTGCTGAA
GTACTAGTTATTACAGCTGTTACTGTTGTCGTTAGTACAGCTACCGAAGAGGTATGACGAGTTGATGCTGATGTTTTTAATTTAGTCGTGCATCGATGTT
TACTACCAGCTCATTATCTATAGATATTTTAGCATATTTATTCAATCCGATAGACTCGCATAAATCTACCTTATCTGTTTGTCTCTCATGTTATTCATTC
AAAAGATTTTGGACTTCTTCGAATGCAGGCGAATAGCAACAAGGAACAGGTGCGATGATGTCTAAAACATTGTCTATCGAAGGTTCTGGTTAATTCATTG
GACGTCAACGGTGCAATTATATGCTCGTCCGAATATTGTGGTTTGGCATTGTAAAGATGTGTATTGGTCATGTCAATATCATTTAGTATGGATCACATAA
GATAGTTTGTCTTACAACGCCGCGTGCACAGCTGTCCAATATAGAGGTACAATTATGAAAGTATAATATTCAGCCCCACCAGTGCTGATGAAGACATTTT
AGTGCTATTTCAGAAGCTCACCCGTACGCTTTGTTGACTTTAGATTCCAAGAACGTCACTATGGACGTGTAGCGTTTGATAGGTAATGACAACACGCAAA
ATACATTCTGTTCGGTCGAAGTATTAACTTAATCCAGCATGTATGTCATAGTGTGAAGAAACAAAATACGCCATGCATCATAACTTAAGGGCTTCAACAG
AATTTATTTATATTTTTTTATGTTTTGCATCCGACAGCCCTCGGCGCGCCGCCCTCTACCCATCATATTTTGGTGCCAGCACCACTTGCTGCGTTGTCAC
GAGGTGCTACATCACTCCTAATCGCATACTTATAAAGTAACAGATAGTAATTAATGGATCTTCTGCATGTTCAAGAGCTTACATAACCGCTGGAATAGAC
ATACGTTTTCCCTTTGGCACTAAGTTGCATCCTTAGGCCCTTTTCATCATGTAGCGACGTGGTGTAGTTTTTATGCGCAAGCATAGAACAAGCTACTTTG
TCGCGGTGGAAATCGGGGTCATCGTAATCAAACTGATCTGTTTGTAGTGAGTCTGACTGATCCGCATATTGCGGAAGAATGGTGATTAGAATAGGGTAAG
TCCTCCATCAAATAAATGTGAATTTATATGTTAAACGCTCATATGAGTGTACTAGGACGTATAAAAGCACCAATCGCATGCCAATCGTCACCGAAGCTTT
TGATGAGTATGGGTAACAACCACATTCCTTTCAAGGATAAATGATAGTATCGGTTGAGACAATTTTCTGTTGGTTATCAGAGATTATCAGCTATCGGAAT
GTGGCGTCATATTTAAATGAATAGAAATAAATTAAAGGATCAAAACAGTGAAAATCTCCGCCAAACCAACCCACTCCACTTTCATCCCCAAACATAGAGC
TCACCAAAACCAGCACAAATAGATATCAAAGATCCCTATGACCACAACGTTTTCAAATGTCTTTCAAGTTGTGCCTCAAAGTCAGAGACATGCAGCCGTC
CTGGTTGCTTGCTGGATTTTGTGAATTTTCTGATGAGCAAGGTGTGACAATTGGGTTGCTGACTTTTAGTCCAACTCTTTTCACTACACACACATGGCGC
AAGCTTGCCTTAACAATGGGCAGCGCCTTTAAATATGTAAACATATGTATGCCAATTGCAGCATGAGCCATCAGCCATTAGCTGCACGGGCGAAAAAGGA
GTTAACGTTACTAAGGGCATGAATCAGGCTTCTATCAACAACATTATCATGATGTGTGCTAAGCTAAATCTATTTTCCTTAAATACAAGCGTCAGCGCCT
GGTCCAGAACCCAGTACTGGAGGAGGCAGTGATCTTCTGGATGCCAGCAGCGTGGGGTTATCCTCATCAGGGATCTGACATGCGCGAAATCTCACAGATT
TTCAGCATCGCTTGGAATCCCAAATGACGGCATCAAATTATTTTACGGAAGGCTCCAAAATCTGGAAACCTCACAAACTATGTGCTATTCATTCACAGAA
CAAGCTACTCTGACACAGGGTAAGAAGGTGCCTCGACATCTCACGTACACGTATCGTGCATAGGAAGGTTTCAATACCAGATAAGGGTAAAAGTAAAACT
TTAGTATAGTTAATCTCATGTTAATAAATCTTATTTAGTCTTATTTTAACTATGCCTAAATACAAACATGTATTGTAAATATCTGCTCA