Description :
From Genome Similarity Track
Location :
scaffold_781:9892- 13143
Transcript NameFunction/comments
Pl_102438glycoside hydrolase, putative
Pl_102439chromodomain protein, putative

Sequence
3251 bases(100 bases per row)
CAATTGATGTCGATCTAACGTTGAACACCACTGCTGGACCAGTGAGGTGCCAAGATTTGAAGCGATCTCTCATCGTTGAGGCTAATGAAAATGAAATTTT
AGTGGGAAAGATTTGTTAGCTGAATTGGGAATTGATGTTGACAGACAACTTGAATATCTCGCATGACGTGCTGATGATGATGACAAATTTTGTGGAACCT
GAGGGTATACCAACCCTCGGATCAGTAGCACCTCAGATAATGATGAATGCGGTCGATGACATGGTTCATGGCGCAATCGATAGAGGTGTTGTTGACGATC
ACATTGCTAGTAGATTGTACACCATTTTGCATCAGTTTGGCGGTTGGAGTTGAGGGATGATCCTCCAGACCGTGTTCCTCCACTCAAAATCAAGTTAAAA
TCAAATACATCGCCCTGCCAATGCAAAGTGCGTCAGTACAGCCCTGAGAAGTGAGATTTTCTGGGAAACTTCAATAAGAGGTTAGCTGACTTGGGACGGG
TATATGAAAATCGCCAGAGTCGGTGGTGTTGCCCAGTAGTTCCTGTGAAGAAGCCAAACACAGAAGAGTACCGCCAAACAGTTGACTACCGCCCTACCAA
CGCGATGACAGAGCCAATAGCTGGTGTCATACCAAGTATTGAGGTTGCTCTCGAGCACTGTCGTGGTAAGAAGTACTACGCGTTATTTGACTTTCTAAAG
GGGTTTTGGCAGCTCCCGCTGCATGAGAACTGCAGAGTACCTATCATATATAACAGACAAACGAGTGTTCACTACAACACGCGTGCCTCAGAGAAGTACG
GACGCGGCTTTACACTTTCAGTCGACGGTACAGATCGTTCTCGAAGAGTTGGTCGGAAAATGTGTGATCGCATGGATAGATGATCTTCTTTTTTTCGGGG
AAACTCAGAATGAATCACTAAATGCAATTGATGCTGTACTACAAATTGGATGGATATGGGTTCATCTTGAACCCCAAGAAATGCTCATTGTTTCAGACAG
AAGCTCGACGATGTGGACGCATCATCACTAGGAATGGGATTGGTTACGACCCGAAACGCATTGAAGCTTTGATAGAAGTGCCTCCCCCAACGACAGCAGC
TGAACTACAGTAACTATTGTGTGCCAGCAACTGGATGCGGTCTGGACTCGTGGACTATGCTCGGGTAGTGCGACCACTCCATGAGCGACTATATCAGGTA
CTAGCAGACGCAAAGAAAACTAAGAGAGCTGCTGCGGGGATACAGATCACCTTACCAACAGCCGAGCTGACGGCATTTAAGGAGTTGACGGATCTGCTTG
GTCATTCGGCAATGCTGGACTTTCCTGACCCAGCAAAACAACTCTGCCTGTTAAGTGGTGCATCAACCACAGGATGGGTTTTGGTGGTTTCGTAAGTAGC
AAATTGGAATCCAGTCACTCCTATCCACGAGCAGCAGCACGAATTACTTGTATGTATGGGGGGAGCTTAACAGGTTCCACTCTCAATTGGAGCGTAATTG
AGAAAGAGTGCTACCCCATAGTACATACCTGTGAGAAACTCGAGTACTCGTTACTGCGTCCACAAGGTTTTCAACTGTACTGTGATCATAGGAACATCAT
CTTCTTGTTCTCGCCGAACAAATAACTGAAACGACATGTGCGGGGAAAATTACTACGTTGGTCTACTAGGCTACTTGAGTACCGTTTTTCAATTGAACAC
ATTGAGGGGATTCACAACGTGTGGACTGACCTCATATCAAGATGGGGTGGCTAACCGCAGGCAACAGCGAGGATGTATTCAGTAAAACGTTTTGCTCGGA
AAAAAGAGAAAGCGTGTCACCCAGATAGTCAAAACCGGACCTACACCGTTGCGTCCACTTGATCGTGAGGACTTTGTTTGGCCTACTATTGATGAAATTG
GCAGACTACAAGCATTGCATAACGCACCGGAAGTTGCAACTCTGGGAGATGATGACATATGGCGAATAAGTAATTTGATTTGGATATCAACAAAAGAAAG
TCAGCCCATCCAGAGACTTTTGATTATTGCACATTGCGGACACCACGGACATCGCGGAATTCATGTGATGGAAAATCACATTCGCCGGTTGTTTTACATC
AGTGGTTTGGGTGGACTTGTGCGTGCTTTCTGCTCGAAGTGCCTATTTTGTCTACATGTGAAAGTGTAGCGATGTTTTTGGTGAAACACACTACACTTTT
GAACGAGACGCGACATTACACTGAGATTTTTTGACTATGGGAGATTCCTTTGGTACATCTCGCTATGAGCTGATTCTAAAAGATGAAGCCACACATTTTG
TGGAACTTGTAGCATGTGATAGCCCTACTTCGAAGGTGACAGCTACGACTATTTTAGACTGGTACAGCCGGTACGGTGTACCAGGTCTTTGGATAAGCGA
CTCAGGATCTCACTTTACAAGTAAAGTGATCGCTGAATTAAGCAAGCGTCTCAAAGGGTGGCCAATAATTCATTCTAGCGTACACGCCATGGAAAAACGG
TTCTGTGGAGAGAGTAAATAGAGATATTTTGCAAGTGCTGAAGGCATTGGCTTTGGAATACAAAGTCAGCTTGCATACCTGGTCCTACCTACTACCACAA
GTGCAGTCAAGCATCAACCACTCCCCAGTACCGTCACTAGCAATCCGAGCCCCAATTGAGTTTTTTACCGGTTTATCATGCCCTAGTGTACTGGACACGG
AATTTTTCCTGAAGGAAAGGGTCGGGTGGCTATGGTGACGCTTAAACCAAGAACAGAGCAGTATCTAGCAAATTGAAGGAGTGGGAATATGGTTATGCAC
AAGCTGTTAAAGACGAACGCACTCGCCAAGTTCAGCGGTACAAAGCAAGACCACACCGCGAGCAACAGGTGAATTTCTCGGTTGGAGATTACGTGTTACA
CTCACGTGTCGACGAAAAATTGCGCGCTAGCAAGCTACGGGTGATGTGGATCAGTCCTTACGGCATAGTTGGAAGCGCGGACTATTACTTTACTATGGAA
CATCTAGTCACTGGTCACACGATGGATGTGCACCCATCTCGTCTGAAACTGTATGCAGACAGTTCACTCAAAGTTACAGAGGAGCTACTTGATTACATTG
CATCTCAAGGCACACTGCTGGCAGTAGAGGCTATTGTGGATCACAGAATGAACTCCGACATGAAAGCATACAAGGTGAAAGTCAAATGGTCAGGCCTCGT
AACAATTGAGGACTCCTGGGGGCCCTTGAAGACGATGAAATAAGATATACC