Description :
From Genome Similarity Track
Location :
Scaffold_274:989- 6750
Sequence
5761 bases(100 bases per row)
TTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGGGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCA
TTTCTTCGACTAGCGGGGTTGGGTTTAGATACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGATAG
CGGATCTCGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGCGGACTTGGGGGGGGGATAGACAGGTTTTCCTTCTAGATCCAGATACACCTCTTTTTCCG
TCGAGAGAGTTCCTCCCATAACTCCATCGATCCGCGGATCTTGTTTCCAATCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGC
TCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATTAGCAAA
ATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCT
TGTGTACTCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAGCTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTG
GAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGAC
CGTAGGGTTGCCTTGCGGATGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTCTAGGG
TATAACCGACCAAGTAGTAAATTCGGTTAACCCGTCGGATCTGCACGTGTATGGGAAAGCTTACTAGGTTGTAGGAACTGGCCAATGTATTATCCAGTTA
TCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATGG
CGCAAATGAGGTTCTGTATTGATATTTAAGACTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCAT
GTCTCTTCTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCAT
CCGGATCCAGGTCGCTTGGATCCACTTCACTGTAAGTTTGCACTCGTCGTCGATCTGAGCTCTCCCATCATCCAACATCATCTCGCAACCGTCTGTGATC
TCCATTGTCCCACGAAAGTTCGAGATCCACTGTATCCATCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATCCGAACT
CGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCTTCAGAGGGCACCGACCATCCTTCCTTCA
TAGGATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTTAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGGTGGATCTTGC
CTTCTCGTACGTCGCACATATCAGATCCATCGTCATTCCACACGGGGTGCACCTCGCCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCAGCCAA
CCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGTAGTGACTCCGCGTCAGGCCCATTCTCTTATTTCTGAAAAAGCACTTCACCACAATCG
CCTCCTGTACGTTGTCGGCGCTGCACAACAGCGTTCACGGCGTGCATTACCAGCATCCACAACCGCTTTCTCCCTTTCGCGACACATGTCTCCCGCCAAG
CGTACCGGCAAATCGTCGGGCAAGGCCCCATCCACTACCCCTCCGGTCAGTCCGTCTTCTATGTCGCCCACCGATCTGCGGGTTCTAGCCCAGGCTCTTT
CCGATCAGGTGCAACCGCTGACGGCGGAGCTCCAGACGGCTCAAGATGCCCAAGACCAAGCTGTGTCCCTACACGCTACCCAACTTCAGACCTTGCGGGC
CCAAGTCCATGACCAGGCTATGGAGATCCAGGGATGGGAGCACCGTGCGGCCTCTCGGTCGCAGGACCTGCGACTCCTGTTGGCTGATCAGGCGGTCGAG
ATCCGCGACCTGACCGGACGGCTGGATCGCGCCTCCCGTCAACGAGACGTTATGCGAGATGACAACGACCATCTCCTTAGGGAGATGGCACTCGCCGGAT
CTGAGATCCACCAACTCCAATCCCGGATCCACGACCTCGAGCGGGATCTGGAGGATTCCCAGACTGCTAGGGCAGCAAAGGGATGTGAGCTTGGACCGTC
TCCGTGACGAGTTGCGTATGACCCAAGAGGAAGTGGTGACCAACGACTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGGGCTTAGCAAGCCCGCGTACCCTGCGCTGTACGTGTGATAGTTGTTGGCCAAGCCCAACCACTTTCG
AAGATCCTTCTGGTATCGGGGCGTTGGCCACGCAGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGGTCGCC
CGGTACGTTAAGGCATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGT
CGATGTGTCTTGACTGCATCTTTGGGCTTCCCGCCGGCGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGAAGGTACATCTTGC
TCCGATTCCCGTCACTGTTACGGGCGAACAAACCTTGCGGTTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCGGGAGACGATTGTCTCGGACCG
AGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGAGCTCGTCTGCAGATGTCCACAGCGGACCATCCGCAGACAGACGGTCAG
ACATAGCGCGTCAATCGAGTGCTCGAGGACACTCTACGCAGCGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGC
TTAGCAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTC
CTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGAAT
ACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTA
TATTTAAGGTGGGGGACTTAGTGTTGCTAGATACGAGGAACCTACATCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGG
ACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTTTACGTTGGACGTCTTAAGCGG
TACTTTGATCCGCAGGGGGTTGCTGACTCGCATATTCACCTTGCCCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGG
CACCCAAGCCTCGGTCGGAACGGCAAGGATGCGGTCAAGACCGTACGCCGGAGGGGCTTCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAG
TACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGCTGGATCATGCGAAAGGCCT
CGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCCC
GCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCTCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGG
CCCTGTGTCGGACCCGCCGTCGGAGCACTCGGACGAGAGGGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCCCTGCTTGACCGGAAT
GGAGAAGTCCACTTCCACGTGGAACGGATCCTCCAGGAGCAACGGCGGCGCGGTAAGCGACAGCTCCTCGTGAAGTGAAGGGGTTATGCCCACTCCGAGA
ACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGCCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTTCCGTGGGTGAAT
ACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCACAAGAATCCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAG
ACCGCCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGGAGTCCGTAAGAGGGATGCGGTGTGGCGCGAGAAGCACATACCGAGCCGCCTCCGAATTGTCA
ACAAACAACAGTTCCTTCTGAACAAGGGTACGCTAGTAAGCACCCCTAGAGGTGTGGCCGCCAACAAGGCCACCAGGAGCGACGAGAAACTCCAGGAAGA
GGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAGTACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGACCCCCCCCCACGCCAACG
CTGGGCAGCTTGGAAGTCCTCCTGCTGCTGGTCGAGGCCATTCGTGATCTCCCGGGGCTCCGAAATAGCACCCTCCTCCTCTTCCTCCTCCTTCTCATCC
TCTTCATTAGAGGAGTCGAAGAGGCCCCGATGAGAGTACCGAGTCTCCTTCTCCTCGCGGA