Description :
From Genome Similarity Track
Location :
Scaffold_7:988605- 991473
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05342hypothetical protein
Phypa_INRA-310PPTG_05343hypothetical protein

Sequence
2868 bases(100 bases per row)
CGTGAATCTTTTTTTCATTTTTTTGTTACGAAATTTGGGCAACATTTTTGCTGTGCCATTTCTTGCTCGATTTTTATTGTCTGCACATGTGCTGGTCTTC
ACTCCACGTTAGCAGTAAACGGGTAACGCGACATCTTGACAACTCAATGCAACCAGGACAGAAACGCTGACGGCACGACACCAACATCATATCGAGAGCA
GGAGTCGGGGGAGGGAAAGCAGCAGCAAACACGGCGTCTCGACATCAAAAACGCAACTTCCATCGTCTACCGCTAAAAAATATGCAGAATATACACATAT
GCAAAAGTGAAAAAGCAGTCAATATATATCGGGCAAAACGCCAAGCCACGGACGCCAATGTGTTTGCAGCTGCAAAGTCCCGCCAAATCCTCCTTTGCCT
TCGCGTCTTCATCTCCATCATCCATGGCACCAACATCGATCATCCTGTGCAGGTCGGATACGCGCTAGTTCTACACCTCGTCCCGTTGCTGCGACAGATC
GTCATTCATCGCCTACCACTGCTGGGCAGGTGCGAGCTTCTCCGTGTTGATGTACAGCATGTCTTCGATCTTGAAGTAGCGGCCCCAGAAGTAGGCCTTG
GAGCCTCCAACAGCTCCCTTCTGGCCCTGCGCGGTCACCAATCGCTGCACGGGCAGATAGGCTGGCGAGTCTGGGTGCAGGAACGTCTTGCGCGTACGGG
CCTTGTTGTACACCAGCATAGGGTGGATGGTGCTCAGCGAGCCGTCAGCCTCCACGGCCACTTGGATCTTGTAGATCTCACCGAGCGAGCCCTCGGCATC
GCCCTCTTCGTTGGTGGTCATTCGGATCACAGCCTGGTACGGGAACTCCTGCAGCTTAGAAGCAGGTTCATCTAGCTTGACGGGCAGCCAAACCATGTCG
TCTGTGGCCCCAGAGGCTTCGGATCCGCCCTCACGCAGCGACTTGGAGTCACCGCCAACGGTCATGAGCTTTACGGGTGTCTTGTCCTCCTCCGAGGGCG
AGTTCATGCCCAACTTGTGCATGTACCGCTTGACACGCTTAAACGGAACGCGAGCAAACTTGCCGCCATGTGACAGAACCTGGTCGTGCACGCGCTTGAC
GCCGAACTCGGGGTGTGCAAACTTGACAGCCTTGATTAGAGCAGTGAGCTCGTCGGCGTCCACGTCGTCGGGACCGCGCGAGGGCGATGGAGACGGCGAC
GAGCGTGGAGGCGAATGCTTGGGAGTCTGCGGCGCGGAGCCGTTCTTCTTGGGAGTTGCGCCGGCCATGGTAATGTAGGCGGTATATGAAGAGCTACTCA
ATGAACTGCGCGAGTTGAGGACTGGCGCAGAGATATCCTATCCGGGGGGAAGATCGGAAACTGAGTTGCGAGCTCTATAACATATGAGCTGGAAATTTTG
GCTCAAAAAATACGGAAGACCGTACTTAAGCAAGTGAAATGAGCCCAGGTTTACCTATTCTCACGTCACAGATTTTGTTCGGCGACAGAAATCGTACATG
CGTCAACATGATGAAGATATCTTAGAGGAGTGGCTGTCGCTGACAGCATTCCGAACAATTCGAACAGGTTTGAGACTGTCCGTGCTACTTGTTTAAAAGA
GTTTACGGTCTGTGAAAAGACTCAAAAGATCTGCTAGCTAACCTTTTGCAAACGTCTCGATACATGGAGTGCAAGGCATTTCGGTGGTCAACATGTAACC
ATAAACTGAGCATGGGCTAACTTAGCATTGCTCAATTGTTCCCATCAGGGTAACGTCCTTGCCGTACACTTCGTAAGAACCAACGCCATATTGGCCCTCC
GAAGGCAGCGGTGACCAGGTACTGTACACAGTGTGAGCGATCCACAGCCATTCAGGACGTACTAGACTAAGAAGGCATCCTGCAGTGAAGATACCTTTAC
ATTCCCATTTCGGGCTCCCCATTCCGCAAAATGGGCAATCTGATCTTCACCTTACCATTGAAGCGGTTCGACACCGGCTCAATGGTCTGAGCCCTGCGCT
GAACGCCTTCTGCGTTGCGTCTGCATTGCGTCGCTGCCTCAATACAAGAACGAGTGGCTACGAGAGCGTCTTTTTCATGTGCATGCATCAATAGTGGGTG
CTCGGCGAACACTGCTCGCAGGGCTCACCCAGTTGCCGCACACTGGAATGACAACTCGGTTCAGCTGATACCGTACTCACCATGCCACGAGAGACTTGCC
GTGTAAAGGAATTCTCAATTGAAGATGAAAGAGGAAACTTGGCAAGTGCAAGCTGTCAATAGCCTACGCTGCAAAGTGTCCTCAACGCTTACGGGCAGCT
TGATATGCGGCGAGGATGAGTGAGTTAGTAACTGGCATAAGCAAGCAATGGTCACGACCGTCATTTTCCTGCCACGTCAGTGTCGCCACAACGAGTGTGG
TCGAGGTGATCACTGCCTGCACGCGAAGCCACCTCGGAGCGAAAGGAGAGGGTCTTATTGTGCAGAAACCGCTCCAGAAAGCAAAAGAGCTATCATGTAT
GTACACCTGAAGACGGGCATTTCTGAATTTCGCCGTCCAGACGCTCTCTTGCAAAGCGAGCCACGGTTGCGCCAGCGCGGCGTGCAATCGTCAACGGCTC
GCTTTCCAGCAACGCTTTTGTATGGATCACGCCGAGAACGTCATTGGACGGTGATGCGTGGAGCATACAGCGGAGACCGCTCTCACCAAGCAGATTTCCT
TGGTTTAATCGTTCATCGTTGTGTCCCGGGATTGTGTCGCCTGTTGATAGCGCTGGAAGAGCGGACTGCAGCCCGTCAAACAGTGAAACAGCTGGAAGTA
CAGCGGCGACTGGGCCGAGGCGCAAGTGACTGGCTTGACTGACTGCCGTGGCGCCGAATTCGCACTCC