Description :
From Genome Similarity Track
Location :
contig_12:98853- 99894
Transcript NameFunction/comments
g3140.t1hypothetical protein AM588_10001528

Sequence
1041 bases(100 bases per row)
GCGCCTGCGAATTGAGTTTATCGATGAGCCAGGGTTGGACGCGGGCGGTCTATTGCGCGAATGGGTTCTGCTTTTGTGTGAGCAGCTCTTTGACGAGAGC
TACGGGCTGTTTCAGAGAACGCATGCTGACCAGTCTGGGTACTGGATCAACCCGAATTCACGGGAGATTCACCGTGATCACTTGCATTGCTTCCAGTTTG
TCGGGCGGTTGCTCGCAAAATGTCTTCTGGAGGGACAATTGATGACGGTGCACCTCGCGCTTCCGCTTCTCAAGCATCTTTTGGGCGTCCCGATCTCGTT
CTCCGACCTGGAGTTCCTTGACGCAGAACTGCATCGCCACGCACTTTGGTTACGCGATAACGAGGGTGCCGAAGCCCTCGCACTTGACTTCACAGTTCAA
CGGCAGGCAAATAATGGCACGGTCATCACTGAGGAGCTCAAACAGGGAGGCAAAGACATCCCAGTAACGGATGCCAACAAGGAAGAGTACCTGACCCTGT
TGCTAAGACACAAAATGTTCGCTGGAGTGCACGACCAGCTCGAGGCACTGCTTCAAGGACTGTACGACGTGCTGCCACGCACGCTTCTGGCTGTCTTCGA
CTACCAGGAGATGGAGCTCCTCTTGTGCGGCGTGCCATCAATCGACGTTGCCGACTGGGAATCGCACACCGACGTCCGATACATGCGTGCTGAGCAGGGC
CTTAACAGACCCTCCAGTCCCGAACGTCAAGTCGTGCAGTGGTTCTGGGACGCTGTGCGTGCATTCTCCCAGGAAGAGCGTGCACGTCTACTACAGTTCG
TCACTGGCACCTCTCGAGTCCCCGCTGAAGGTTTCCGAGCGCTGCTCAGCCATGACGGTCGTATCCGTCGCTTCGGTCTTCAGATGATGCCCCTCGGTGC
GCCACCCACAGGCCTATACCCGAAAGCACACACGTGCTTCAACCGCCTCGACCTTCCTGTCTATCCCTCTTACCAAGAGCTCGAAAAGTACCTCACCCTC
GTCATCAACATGGAAATAGCAGGATTCACCATGCAGTAAAC