Description :
From Genome Similarity Track
Location :
Scaffold_1025:9884- 11846
Transcript NameFunction/comments
Phypl_g12106hypothetical protein PHYSODRAFT_494903

Sequence
1962 bases(100 bases per row)
GTCGCCGTCGTACTGGCGGGGCCGAAAGCAGGGACAGGCAACAATCGAGACTCCTGCGGACGCTCTGCTGGATAACGTCATGTTGGATTTGAGCCCGGAC
TTCGAACCGGTCAGCGCCGATCTGCGGGAGCAAGAACAGCGCGGTGAAGCCCTCACGGTAAAGCGACTTCGCAAGGTTTTCCAGGTTCCGGGTGGTGAGA
AGACTGCTGTCAAGGGACTCGATATCACCATGTACAAGGACCAGATCACGTGTCTGCTCGGCCACAACGGTGCCGGTAAAACCACGTTGATCTCCATGCT
CACGGGTATGACTGCGCCTTCGAGTGGAAACGCCACGTACCGGGGCTTATCAATCAACGAGgacatggacgagatgcGCCAGTCGCTCGGTATCTGTTTC
CAGCACGACGTCCTGTTCCCGGAGCTGTCGGTCCAGGAACACCTCCAGTTCTTCGGACAGATCAAGGGCTACGcgaacgaggagctgcagactgTCGTGG
ACAGACAGATTCGCGAGGTCGGATTGACCGAGAAGCGCAACTTGAGACCGAACGATCTGTCCGGTGGcatgaagcgcaagctgtcggtggccgtgtcgct
gctgggcgacagcTCGCTGGTGTTCCTCGATGAACCGACCTCCGGCATGGACCCGTACAGTCGTCGCAGCACGTGGGAGATCCTGCTGAACAACCGCAAC
GATCGTGTTATGGTGCTGACGACGCACTtcatggacgaggccgacatCCTGGGTGACCGCATTGCTATCATGGCGGAAGGCGAGATGCGTTGCTGCGGTT
CGTCCCTGTTCCTCAAGAACCGCTTCGGTGCGGGCTACAACCTGACTCTGgtgaaggacgacgccaagtgcgacgacgatgccgtgGCTGCGTTCGTGAA
GTCGTACGTGCCGTCTGCCCAATTGCTGAGTAGTGTCGGCAGCGAGATCGCGTTCCAGCTGCCTCTgcacagctcgtcgagctttgCCACGATGTTCGCT
GAGATGGATAATCAGTTGCAGACGCTGGGTCTCCTGTCGTACGGTGTGTCggtgacgacgctggaggaggtgttcatcaaggtggcggagctggccgacg
aGAACAATCAGCACACGCTAGGCAACCATGCGGCGCGAGCGAACTCATCGGGCTCAGGCGAGTACTACCAGCCGTGCGACGAGATCATCACGACGGAGTC
CATCTTTCAGAGGCActtgcgcgcgctgctgctcaagcgttTCCGGTACGCCAAGCGCGACAAGAAAGCGATCATCTACGTCGCCGCACTGCCGGTTCTG
CTTATTGCTGCCGGTCTGGGGATTCTCGAGGCCAGTTCGGCCATTAGTGACGATCCTCTCAAGGCTTTGACGACTGATCCGTACTCCGGCAGTGCAACCC
CAACGCCGTTCTTCTGCCAGACTGGAGCTGGGGCTGGAGAATGGTGCAGCGACGTGATGAGTTCACCTTACTACTCCGGTGCCGACGCACAAATGCTCTC
GATCCCTGAGCCGGCGTTCGACTCCAACTCCCCCACCGTCTTCGGGGTCACTTACACGGACCCGACGATCAACGCAAGCGGAGCGACGGGCTACAGTGTG
GCCATGGGTCAACATGCGTACGAACGTGGATACGGCAAGGGAGCCGATCTTGTGGAGGGCCAGTATGGCGGCTACTTGGTATacggcgacagcgaccagA
ACTTGCTCGGCTACAGCGTCTTCACGAACACGACAGCTTCGCACTCGTCGGCCATCTTCAAGACAATAATGGACCAAGCTGTATACCGCTACTTCACGTC
TAACACTTCCCAGGACTCGGCAGGCTCGACGGTCGATTTGAAGGTGAACAACTACCCGCTGCCGTACACGGAAGCTGCGAAGGCAGTGCTGAACTCCAAC
TCCTCATTCACCGCGGCTCTCTTCATCTGTATCGCGTTTACGTTTCTGCCGGCGTCCATTGT