Description :
From Genome Similarity Track
Location :
Scaffold_10:988348- 990507
Transcript NameFunction/comments
Physo_130322predicted protein

Sequence
2159 bases(100 bases per row)
GTCTTGGTCGAACACGGCAAAGAGAACCAACGGTACGCTCGTGTAGAGAACGTTGAAACTCTGTGCGGCCACATCCAGGATAAGGGGCTGACCGGAAAAC
CCGCAGAAGCAGCCGAACCAAAACGTTGTGAGCACATACGTCACGTTCTTGTAGAGCATGTAGCTCATGAGCTTCGCCACTCGACGGTAGGCCCAGCGAC
CGTGCACAAACAATAGTCGCTGCAGGAAGCGGAATTGAGCCAAGGCGTAGTCTGAAGCGTTCACAGCCTGCGCTCCTTCCTGACCGGAAATACCCACACC
GATATGCGCAGACTGGATCATCGCTACATCATTCGCTCCATCTCCGATCGCAAGCGTCACGCTGTCCGGTTCAAATTCACGCACAAACTCAACAATCTCA
GCCTTCTGTTTGGGGGACACGCGGCAGCAAATTACCGCTGAAGCGCACTGCCGAGTGACTTGGTAGAACAATTTGCGCAGTTGAGGGCGAAGAGCGAATT
CGAGGGCTTGTCCATCGATCACGAGTGCTAACTGCTGCGATGATGGGCCATTCTGGTGACGCTTTTCGCCACCGTACAAACTTCCAGTGAGAGACCCATA
CTCAGCGGTGTGGATTGCCTCGTCGTCAGCGTCAATCCCGATATCATACAGTGATTCTTCATCGGACGTGAACTTGTCGGCACACTCAGCGTCAGTCGCA
ACGGACGAATACATCGGTGTTTGGCTGAACGTCGAAGTCCTGGACGTACGACGACTTCGGTGGCGTTTTCGTTTTTGTTTCCGCTTGTGCTTTGCCGTGG
AACCGAAGAAAAACTCGCTGATCGCCGCTTTCGCACTACCCAGGAAACTGTTTGTCCGGGACCGTGGTCTGCGTCTAGCATCATGAGAGCGACGGCGCAC
CCCTCTACCTCCTTTGGACCTCGAGGAAGAAGAAGTGAGGGAAGCCTCACTTCGCTGGGACAACTCCTTTAGTGCCGCAGCTGTCGAGCTGTAGTCATCA
CCGCCAATTTGCTGGACGTCCATATCGTGCGAGAGCAACGCACTAGCGTATCCAATGTTCACAGCAGTCTCCATTTTGTCGCCCGTGAGCGTCCAAACTT
TAATTTTTGTCTCCTGCAGCAAACGTAGCGTCGCAGGCACTCCAGCTTGCAACTTGTCTTGAACCGCAGTGACACCAAGCAGGATAAGGTCGCGCTCAAT
CTCGTTCATCAGTGGGTCAATTGCATTTTCACGGCCTTGGCGTCGTTTAACCAGTTCCTCCATGGAAGCATGGGCCTGGGAATAACGGGCATTCCAGTCC
TCATACTCCGACCTGCTAATCGTTTTATACGCGAGACAGAGTGTGCGCATACCAGCTTTCGCATACACCGTGAGCTGGTCTGCAGCTTCATCGTAGGACA
TGCCGCCAGGAATCGTAGCTTGATCGGCCGCCAGTCGTTCAAAGATCACATTGTCCGCCCCCTTGCAAAGAAGCTCGAGTGTACCATCGGGAGTTTCAAT
AATCACCGTCATTCGCTTTCGGTCGCTGTCGAACTCTAGCACATTCAGCAGTTTGTATGTGCTAGGTGCCGCCCACCCCGGTTCCATGAGCATCATAGTG
GCGGGTGTCCTGTGTACAAACCGGACATTGCAAAACGCTGCTGCTGACACCAGTGCTTGCTCGTCAGGCGACGAGGCAGAGTACTCTGGGAACGACGTAC
TACACATTTCTGCAAGAGATTTGGTGGGGATCAGCGTATGGCACAGCGCCAAGTGTCGTAAGAAGCGGCGCAGAGTTTCCGCCTGCTCACCTCCGGTTTG
AAGATCAGCAAAAAGCTCGGATGGATCAAAATCCACAAACCTTGGACCATCCTTCGAAGTTATCGATGAGGGAGACGAAGCAACGCTGGGGACCTCCGCC
TCCATGTCTTTGTCTTGCATGATCCCACCGTAATGCTTTCCCCCGACCATACAGTAACGGAAAAGCATGAGGTTCATCGTGAGTGTCCCGGTCTTGTCGG
TGAAGACATGATGTACGCGACCGAGGTCTTCGTTCAGCGCCGACGATCGCACCATGGCTGGAGTATCCGACGGCTTGTCGTACATTTCCAGATCTTGCTC
GATAAAATACGCTTGCCAATACTTGACGAACTCCAACGACACGTTCAGCGAGATAGGAA