Description :
From Genome Similarity Track
Location :
Scaffold_3:9883- 11032
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3-snap-gene-0.50Ankyrin

Sequence
1149 bases(100 bases per row)
CAGAAACTCCGCGATCTTGATATTCCCTCTCTTCAGAGCTTCGTTCATCGCGCTATCTGTACAACCTTCAGGTCGGTTCTCATGGAGCCACTGTACCACA
TCTAGATGCCCCGCTGCCGCTGCATAATCCATGGCGTCAGTAGTGCAGCCTTCAGACCTATTTTCATGCAGCCATTTTACCACGTCAAGGTGCCCTGCTC
CAGCAGCACTGTCCATCGCGTGAGTCGTACAGCCTTCTCTGCGATTTAAATGAAGAAACTTGACGATCTTGAGATGTCCATCTGCAGCAGCTCCATCCAT
AGCGTCCGTGCGACATCCTTCGCTTCGATTCGCGTGAAGCCAGTAGACCATCTCCAGGAAGCCTTGCTGTGATGCCCAATCCAGTGCATCCACTGTACAT
CCTTCGCCTCGGTGCTCATGGAGGAATCGCACAACTTCGACGTGGTTCCGAGACGCAGCTAGATCCATCGCCCTTGTTGTACAGCCCTCAGTGCGATGCG
TTTGAAGAAACTCGACAATGTGAAGATGTCCATTCCCAGCAGCTTCGTCCATCGCAGACGTCGTGCATCCTTCAGACCGGTTTTCATGAAGAAACTTCAC
GACATCGAGATGACCTTTCGCTGCCGCCCAGTCCATCGCTGCTTCGGAGCAGCCCTTACTCCCGTCACCGTCGTACTCATGAAGAAACTTGACAATTTCT
AAATTGCCGCCTAGAGCTGCGCGGTCCATGATTTGATGATACTCGAAAGCAGAGCTTTCTTCTTTTTTTTGGTGACAGCCGAGAAGAAACTTGACGATCT
CGAAATGACCGTCTTCCGCGGCGAAGGCGATGTCATCCTCTGACGTCTTCTCTGGGTAGTGAGCGTAGAGCCACTTGATGACTTCGAAATGGCCGTACCA
GGCTGCGTATGAGCTGGCTTGATAGGTGCACCCGGATTGGCGATTCGCATGCAGCCACTCGATGACCTCCAAGCGACCGCTGCGCGCTGCACTATCAACG
GCGTCAATCGAGAACTCGATTGTTGCGTGCTGGTCGAGCCACTTAATCATCTCCAGGTCGCCACGACGAGCGACTTCGTCCATTATCTCGACAGGCACAC
GTGCGCCAACGATCCAGCCGCTGAGCCACTTGACGATACTGAGGTGGCC