Description :
From Genome Similarity Track
Location :
Scaffold_389:988- 4564
Sequence
3576 bases(100 bases per row)
CTCATGACTCTGCATAGCTTCGGACCGATTATGACACGTCTGCTTGCATTCAAACCCTTGCAGTAATACTCCACGATTTAAAACAAGTTCATCCACCCAT
TAGGGGTCCTCGTACCCCTTCCAACGAACGAGAAACTCTCGTTGCTGTAGCCCATAACGTGTTTTCTTACCAGTACGACTCTCCAGAATCTCTTCGACCT
CGTCTATGCCCTCCTTCAATTCTCGAAACCAATTGCCTGCCGGAAATAGGCATTCGTCGAAGTCAACTCGATCTGCCTGGTCCATCGCTAGCTCGTTGTC
TGGTCGATCTGTTATTACCTAAATTTCTTGAGCTAGGATATGTTTACAATCGGGAACAACCGGTATTCGGTACCCTGGGTTTGGTCTCCCAACAGATCCA
GAACGCGGAAAAATTCTGTACTCAAGATGAGCCAGTTTCCTGGCATACCCTTCTTTTACACGGTCGAGATAAATCCATACTTGGGTTCTCGGTCGAATCT
TGTGGTCGACAACCTCTTCGTTCTGTAATTGCGCTCGCGTCTGACTCGCCTCTCGCAGTTCTCATTCACATGTTCTCTTTCTCACTGGTACACGCGGTAA
TTGCACCGTCTGGGTTCTGAATCCTGACGTCGGACGTTCACTCTCGGTAACGTGGCTTCAAGGTTGGATCTGGCATCTCAACCGTGGACCAGATAAAAAG
GCGTTTCTTTCGTACCCGGTCCTGTGTGGTATTGATCGCAAACGTCAACCGCTCTGCGTACTCGTCCCAATCCTGATGCCCCACGTCCGCAGCGTACAAC
TTGATGGATCTAATTAGAGTCTGTGCCATCCTTTTCGCCGTATCAAGAGCTTGGGGTCGGTAGGCCATTGTCGCTTGTTGACGTTGACCCAACAAACTGT
TAAATGATCGGAAGACATTAAACATAAATCCCAATTCCTTTTCGTGACGGATCGCTTCGCTAGCCCTAAAACGACGGTAAACACACTCTTCATATCCCTC
AGCGACCGTTTGAGCTGTCCGCGATGCACGAGCCTTGGCCATTACATATCCGGTGAATTAATTAACCCATATCAGAATTTCTGTATTTCCTTAATAGGAC
TTAGGGAGAGACGGGATATGGTCCAACGCTGTAACTTGGAAAGGATAAGTCGCCACAATATTTCCAGATCTCTTCCCTTGTAGGGTGGTCCACCTTTTCC
GGTCTCACAATCCATGCAAGAACACACATATCTCTGCACTCCCCGAAACGGACCTTTTCAGTGACAGTACCATCGTATGCGTTGGTAGAAACGCCCGACT
CCTTCATGAACTCCTTCTCAACTTGTATGGTAGTGGTGGAGAAAGTCGGTCTGGAGACTTTGAGGTATCACTAGTCTGGCCTTCATGTTACGGCCTTCTC
CCTCGACTCTGTAGTTTGGACAATAAACCAAATATCCTTCCTCGCTTACATCGTAATCTCCGTACATTTTGCTACACGTTTTAGCGGATTTCACCGACAG
GTCACTCCAGTCCGCCCTTAAGTATGCATTTTTTAAATCTCGTACCCAGCTCTTCTTTTCTTGCGCCTTTCGAATTCGGTCGATGCGGAGTCGTTGTACT
ACCTCCTCTTGTATGGTCTCTCCGGATATCTTAACAGGAGACCGCGACCGAATCACCGCTAATATTTTGGTATAGAGGTTCTGGTCTTCAGATAACAAGC
ATCTCCGGTAGACTATTGATCGCTTCCAAGCCTAGTCTTTCTTCACTCGGCATCGACTTGATCCCTCTTTCTGGTGCAAGGCTGCACTAGCCAACTGATC
CGCGCTCTGATTCCAATCTTGTTTCACATGCTGGATTTCGTGAGAAGGCCCCGATTGGAGGTCATTTAAGTTCCGGGCTCGTTGCGGTAATACACCCGAG
GCCTTACACCAAATCTTCCCCCGCATCTGCCGCACTTCTAAAGTGTAGTCTCTACAGATAATCAACCGCCGTCGTTCCAACGGTTTCAACAATTCAAATC
CCAGCAGCGTACCCTCATATGCTGCCTCATTTATCGTGGGTGAATCGAGATATTTCGAGGCGGCTTCGAATATAGTCCAAGCTGGGAGTCTTAATACGAT
ATCGCTACAAGCCTCACCTCCTTGCTTGACACAGGCTGACCCATTGAAACTCATTACGCATAGTTCTTCGTCTGGTTCCACGGTAAGGGTAGGTAGGTCG
ATCGTCATCCTCGCCTGCTTCTTAGGAGCAATGGACGACACAATTGAGTCGACACTCTTTCGAGGGTTAATACTGGCTTCCAACGCCCCCAGTACCTGGT
CTTCACCTTTTTACACTTCTCATCTCCAAAGTCCACTGAGACAAGAAAGCCGCCCACTTTCCAAAGTGCCCCTGCAAGCCGGCAGATTTCATTAACCACG
CACATGTCGAGTGTCTAGTCAAGACTTTGAGGGGGCGAGGGACCAGCATAGTGAAGCAGGTCTCCATTATACGCAATAATGCTAACACTTCTTTCTCCAC
TGTACTGTAATTTATTCGTTAGCCTTGAGGGTTCTGCTTGTTAAATTTACCGGTATAAGCAGTCCTACATAATCCTGCACTAGTGACGCCGAAATGGCTC
ATTTACTTGCATATACAATAATCACAGCTTCTCAAATCGGGTCGAAATGTCCAAAAATTGGCGCTGTGGCAATTTTATTCTTGAGCATGGCTAAGGCTAC
TTGAACACGGGTCCACCTTTCTTCATTTTCATCCTGAAAAGTGGCATTGTTATCTCCCTTCAATTGGTTTTGTCGGGCATGAAAGTCCACCTCTCTCAAT
TAGTAGAGAATAAATGGATAAACGGCGTAGTCTTTAATAAACCTGCTACAGTAATTCAAGCTTTTCAGAAAATATTGCATGGCCTTCAGTGTCATTGGTA
AGGGTAGGTCGACCAGAGATTAGAGGTCTTTCAAGTAAGCCTCAAGTCCTCCACTAGATACTCGATGCCCAAGGTAGTCGCCCTTCCGATATCCCTACGA
ACTCTTGACCTTGGTGATTGACAAATTGTAGTATTCGCACACATCCAGTAGCCGTTTCACTTTTGTCAAAGCACGTCCCAGGATTCGGCGGGGATCAGAA
TGTCATCTATATATGACCTCTGACCCAGGATCGAGGAAACCGACTCCTCATCTGGCTCTCCCACCTTGAAAATCCTTCGACCCATCTGTCTCTACTCCTG
GAGGAATTCGTAAAATCCCGTATGACGCGTTATCCAGGAGTCGCTGATATATATAGGGCGCGTTCTTGAGCCCAAACGGCATCCGCAGCCATTCAAACAA
ACCCAGTGGGGTAATAAACGCCGAAATTAGTCTCGACCTTTCAATTATACCGACATATTAAAAACCACTCGCCATGTCTAGCGAGAAATAACCTAAGCCT
TGTCCAATTCTTCCGATAGCTAATTATCTAGAGGTATGGGGTAGACCATAAGTTAAGTCAATTCATTCACCAATCTATAGTCGATGCAAGCCTGATGCCC
ACCTCATTTTGTTTCGCAATAATAGCGATTGGGCTGGCCCATGGCGAGTTAGAAGACTTTATAATCTTCGCAGATA