Description :
From Genome Similarity Track
Location :
scaffold_1366:988- 4352
Transcript NameFunction/comments
g11332.t1 reverse transcriptase
g11333.t1 putative polyprotein
g11334.t1hypothetical protein

Sequence
3364 bases(100 bases per row)
CGACAAGGAGTTGTTGGCGATGAGGTACGCCCTCATCAAGTTCCGTGTCCACCTCATCGGTGAGAAGACCTTCGCTCTGTATACGGACCACGCGTCACTG
CGGACCGCGACAAAGAGTCCGCATCTGAGCCAGCGCATGGCTCGCTGGCTCTCGCTCTTCTCCGAGTATAACTTCATGGTCCACTACAAACCGGGGTAGA
CGAACGTGCTCGCAGACGCGTTGTCGTGCCGCCCCGATTATGATCCGCGGCGCGACTTGGGCCATTGCTCGGGCATCGCGGATAACGACGATGAAGATTG
CGCCACATGCCTCGCTTCGGGAATCTGTGCCGTCGAAACCTCGGTAGTGTCTGACCTGCGCCGGGCCATTGCCGGCGCATATATGGACGACACGGACCTC
GCGCCTATCGTCACTTTCCTGCGCTCGCCAAACGAAGATGCGCGGAACAAGCTTCCGCGCCGAGTTGTATCGCGTCTTGACCGATACTCGCATGATGACG
ATCTCCTCTTCTATAGCATCGATCGGTTCGACGCACCACGCGTGGTCGTTCCCAACGATAGTGATCTTCGAGCTCAACTCATCCACGAGTATCACGACGC
CCCGACCGGCGGTCACTTGGGCCGTGAGAAGACGTACGCGGCCCTCTCGCGTTCTTACTACTGGCCTCACCAGTATCGATGGGTTCGCAAGTGGGTCCGC
TCGTGCGAGACGTGTCAGCGTGTGAAGCCATCCCCGTCCTCGCGGGCGCCGTTGCACCCGCTTCCTGTAGCGCCAGATGTATGGCGCTCCGTCAGCATGG
AATTCGTCTTTGGACTGCCACCCGACGCCCGTAGTCGCACGGGCGTTCTCGTCTTCGTTGACCGCTTCTCCAAGATGGTCCACCTCGTCCCAGTGTCAGC
GAATGCTGGCGCCGAAGAGTGCGCGGCGCTCTTCATCGATACGGTCTTCCGGCTCCACGGACTCCCTGAGTCCATCGTGTCTGACCGCGATCCGCGTTTC
GTGGCGGCGTTCTGGCGCCGTCTCTTTGTGCTGCTCGGCACGCGACTGATGATGTCCACCGCTGCTCATCCGGAGACGGACGGCCAAACTGAGCGCGTCA
ACCGCGTTCTGGAAGATGTGCTCCGCGTCGTGGAGCGGGTTTCTCCCGCTCGCTGAATTCGCCATCAATAACGCGGTCCACGCGTCGACTGGCTTGACTC
CGTTCTTCATCAATAACGCGCGGCATCCGCGCATTCCGGTACTCCTCGCCGCGGGCCTTCCCGCGGCTCCTCCTGGCTCCACTCTTAGTGGGGGAGAAGC
TGCCGCTGATTCTGATTCTGATTCGAGTTCCGCTGATCCGCCTGGTTCGGATCCAAACTTCGGCGCAAATGCCGTGACGCGCTCGACGTCCAAGGCGCCC
GCCGATGCGGGCGCTCTCGCGCAGTGGGCATCGCGCACTCTGATAAGACCGAGCGCTGCACCTGGCGCAGCGCCTCCCGCTGCTAACTTCGCGCCCAAGC
CTGCCATGAAGCCCAAGGATACGCTGGCTGTAGACGACTTCATCAGCCAGCGTCAAAGCGTCGTGCGGTTTGTGCGCGACGCACTTCAAGCAGCAGCAGA
CCGGCAGAAAGAGGCCGCGGACAAGCGCGGTCGCAAGAATGTGAACGTGTACCGCGTTGGCGATCGAGTGCTGTTATCAAGTGAAGGGATCAAGAATGCA
CCAGTGACGAACTTGGGCGCGAGCAAGCTCGCGCCACGTTTTATTGGCCCCTTTCGGGTTATCAAAGCACATGGAGACGCATACACACTCGACATACCTA
CGACGATGCGCTTGCACCCGACATTCTATGTCGGGCGCCTGAAGCCGTACAAGCCTGCAAAAGTCCCAGCCGACGAGCGTCGGCGCTCGTCACCTACGTC
CGGCTCCCCAGCTGACGCTCGAGAACCCGAATGCGCTCAAGAAGATTCGCGCTGCGCTGCTCCGCCCGTTCCGCGCGGCCCTCCGCAGCGCTCGCCACGT
CCTCCGCGCGCTGGGCTTGTTCCATCGCCTCCTGCGCGTTGTCGCGAGCCTGCTCCGACTCGGCGAGCACAATCCGATCGAAGTCTGAACGCGCCGCGTT
GCGCGGCGCATGTTCCTCTTGAGCCGTTCCACCGCGATGGTCCTCCGTCGCTGGTTGACTCCACTGGCGAGACCCACTGGGTCGTGGATCACATTGTTGA
CCACGACGATCTTGGTATTGCTCCCACCGGCTCCAGTCGTAACCGGGATAGCGCCGTGCTTGCGCGGCGCCGCTATCGTGTCCGCTGGCTCGGGTATCCA
CCTGAGGCTGATACATGGGAGCCGCGTGAGAGGTTCGAGCGCGACGTTCCGGATATTGTTCACGAGTACGAGTCCAGTCTTCAGGCCACGGCACCGACAC
CTGACGTCGGCGCGACGATCGAGTTGCCGGCGGCGAGGGCGACGCATAGTACGCGTTCACATACGCCTGGTCCCCGCGAGGAGAACGCGCTCGCGAGCGC
GAGCGCCCACGTTGACGAACACGACGACCAGCCGATGACGAACACGAGCGACGACGCTTGCGATCCTGATTACCGCGCTCGCGAACAGACGAGCGCCCGC
GCTGCTTATCGTCTTCGTCCGCCTGATGACGACCGCGGCCTTGGTCGCGGTCCACATGCTGCTCATGATCGCGACTACGGACAGGCTGGCGGTCGTCCCC
ACGCGCCGCGACTAGCGGCAGCACGACGGGTATTCGAGAGCACGGACTCATACCGCGCGATCCATGAGCGCTCTCTATCGGACAACGGCTTGACTGCAAC
TTCGGCGTCCCACTCGGCGCGTGCGTCGCGCGCCCTCGACTTCGCAGACTCGACATCCTTCGGCAACTTCGACGTAGCAGATGCGCTCGACTTCCCAGGC
CATGGTGCAGATTTGTCCACGCAGTGCGCCGAGCGATCGGTATCGGCGCTTCCTCTCTTCTTCATGCAGCCATACGACGAAAGGCTGGCCGAGCTGGTGA
CGCTCGTTCCAGCGCTTGATGAAGGCGCACCACGAGTACTGGCGCGCGTGGTACTCGCCCACGCTCGTCTTACCACGCAGCGCGCGGTACCGGTTCCAGT
ATGCGATCACCGTGTCTATGGAGTCCGGCGCCACGGCGCCGGACAAGTCGTACAACTGCCAAGGTCGCAAGTCCGAGTCCAAGTAGTGCGGTCCGATCGG
CGCCGACGCAGACGCAGAAGACAACGCCACCAATGGTATGAGCGCGGCTTCGACCGGCCGCGCAACAACTGCTGCTCGCACTGTTCCTGACTGCGGGTCC
GTCACTGCGTTTGCCGTGTTCGCCGCGCTTGCCTGCGGCGCCGCTGTCTTCTCTTCGAGATTGT