Description :
From Genome Similarity Track
Location :
scaffold_12:98796- 121571
Transcript NameFunction/comments
g765.t1hypothetical protein
g766.t1 conserved hypothetical protein
g767.t1 ribosomal protein L38
g768.t1 hypothetical protein PHYSODRAFT_353568
g769.t1 polyribonucleotide nucleotidyltransferase, putative
g770.t1 conserved hypothetical protein

Sequence
22775 bases(100 bases per row)
ATCGTACACGACTGTAAGCTGAAGGTGGACGGCATTACCAAGTATCTGGACAGCAACGCCTTCAATTTTGACCATACGTTTGACGAGAACGCAACCAACC
AGAGTGTGTACATGTTCACTGCTCAGCCGCTGGTGAAGTTTGTGTTCCATGATGGAGGCCACGCCACGGTGTTTGCCTACGGACAGACGGGCAGTGGCAA
GACGCATACGATGCAGGGGATTCAGAGCCAGATTGCGGCGGATGTGTTCGCCCAGGCTGACGAGTTTGCCAGACGCGGCTATCCTTTGGATATCTGTGTG
AGTTTCTTCGAGATTTACGGTGGACGTTGCCAAGACCTACTGCATCGACAGGTGCTGACTATTCGGGAAGATGGCGCTGGAGAAGTGCAGATTGTGGATC
TGGAGGAGGTACAGCCCCAGAATACGGAGGAACTACTGCAAGTGATCAGCAAAGGCAACAGTCTCCGCACGACGCATGCTACTGAAGTGAACGATGTGTC
GTCCCGCTCGCACTGCATCTGTCAAATTAACCTCCGCGAGAAAGGGTCAGGAAGACTTCATGGCAAGTTATCTTTGATCGATCTTGCTGGGAGTGAACGC
GGCGAAGACACGAAAAATCACAACCGGCAGCGACGGATGGAATCGGCCGAAATCAACCGAAGTTTGTTGGCCCTGAAGGAATGTTTCAGGTATGTGCACA
AGTGCAGTAATTGAATCCTGGCCTGCTAAATTGCTGATAACCATCCACCTTGTTAATTCATAGAGCACTGGACAGTGGTGGCCGAGGAGCCCACATTCCT
TTCCGAGCGAGCAAGCTCACTCAAGTGCTGAAAGATTCGTTTGTCAACGCTAAGGCGAGGTACGAAATGATCTCTATGATTATTATCATCAACCGAATCT
AATGATGTGATTTTTGTAGAACTGTCATGATTGCAGCAGTCTCGCCATGTGCCTCGTCCTCTGATCACACACTAAATACGCTTCGTTATGCCGATCGGGT
CAAAGAGAAACGTGTTTCAGCGGATGCATTTGACGAGGGGAATGCAGAGTCTGATCCCGTGGATGTCGAAGATGTCCAATTTGAAGGTGCGTCTGAGACT
ATAAGCTTCGATGATGATCATGAGTAATTTATTTTGTGAGTTCTATTGTGTATCTCAGACCTCGACGGTGATGACGCGTACACTGGACAAAATGAAGGTG
ACGATGTCGACGGAGAATTTGACGACGAAGAGGACTATCCGCTTGAGGACGAGGATGAAATGGTGCGCGAAGGCAAAGGCGATAAGTATAGGGATGTTGG
CGACGGCAGTAACGACGTCGTTACGAGTTCATCGCACCATGCTCGTGGTGGTCAAGATTTGAGAGACGATTTGAGCATTCTTCGCATTAGTCGTCGGCGC
AATTCCAGTACGTTGAAGGCGAGTGGTTTATGGGGTGCCGAGTCGAACTAACGTGCTGTATGCTGATATCATTAGATAAAAGTGGTGGTGACCCCGTTCA
GAAAAACGAGTACCCTGAAGAAGCGTGGCAAGGAGTGGTAAGGAATACGTTGGGGCTTTCGAGCCGAAGATAGTACTAAGAAGGCAATGGATGACTGTGT
CCCGGGCAGGTTCAAACATTGTACGAAGAGCAAGAAAGTTTGCTCAACACACACATGAGCGCAATTCAGGTTTGGTTCTACTTCGTAAGGGTGCAGGTTA
TGGTTCATAACTAAGTGGAGGCGTTCTTATGATGCGATAGGAAAACGCAGAGCTACTGACAGAGGAAGGCGCCATGTTAGCAGCAATTCAAAACGACGAT
TCAGCGAGCATCGAGCAGTACGTGTCGCGTCTGGAAGAGGTAGGTGTTTTGAAGGATATCTCGACTGCAGTACGACTTACAAGTCTGTAATCTCTGGTGG
ATGGGTGACAGATTCTTGCCCAGAAAGCCCAGACTATCAGCACTCTACGACGGCAACTTGCTGCCTACCGTCAGCATTGCGAAGGCGAAGAGGAGGAAAA
GGGAGGCGATTCGCCTCCCAAAAAAGTCTTTGTTCGCGGCACATAAGAGTTGGGCTACACTTCACTAACTGCAATGCGATTGATAACATTGCCAATGTGT
TTGCCCGAGAATAATACAAATGAAATACATAGAGCTTTAGCTCGGATAGATGCTCGCTTCACAGCATTGCCTATATTCACATAAGTACGATTGAAGCATT
CCTAAAAAAGCTAGGAATTTATCCAAACATGATGCAGCACGTACTCACGACGAAGCTTCTCGCGCGCGCCGTAACAGCCACAAAGGGGCAGGCTCGTCGT
CTTCCAGTGGCAGTGAAAGTCTCGCTGTGCCGCTCTGCTACACAGATGCAGAGCTTCCAGGCTACACAGCCCTTTAGAGCTCTAGCGGATTCCAGAGACT
CATCGTTTAATGGCCTCGCAGCTCTGGCTGGACTTGCCGCGCTCGTTGGGGCTACGGGGGTCGCTGTGGATACTGCACAAATGGAAGCAACCCCAGACAA
GAAATATGAAAAGGTTTGAGGGGTTTCTCCGTGAGTAGGAAACTTGTAGCACTGGCTAAGTTGTTGTTGTGTTTGTAGCATTTTGAGTACGCTGAGGCTG
TGGATATCATTCGCCAACAAGTGTCGGAGTTCCGCACCACGCTCAAGAGCTCCGAGACCCGCATCCCCAAGGCTTTTCCCATCAAGAAGATTGGGATCTC
CAGGATCCATGCGCCGAATGGCGTGTCGACGATTCGGATTGAGTTTGCGTGTCCATCATTTGTTGATCAAGAGGCGATCTTGGGTCGGTTCTTGCTGAAG
CTGCAAAAGACATCGACACCTGGTTCCCGCCAAGCTGTCGAGGTGATGCCAGCTCCGTTGGATAGGGCGACGAAGAAATCTGTGGTGGAGTCCTACGAAC
AACCTGCGGTGACGTACCTGTACACGAACGGATCCGGCTCGTTCCAGTTTCTGCGTGATACAACGTCGTTGCAGGCAACGTCGAAGTTCGTTTTCTACAA
GGATGAATATCTCACGCAAGGGGAGATTGACGCTGTTGTTGGTGCCTACAAGGAGATTTACTCGTATGCAAATGTGAACGCGTTCTTCCGCCATGATCTC
GAGCAACGGCGTAAAAATGCACTTGTTGGACGAGGTAGAAATCTGACTACCGCTACATCTGCACCACCCGACTCCAAGGTTCGTTGTATGTCCTCGGTGG
AGCCTTGTGTTGATACCCTACCTCACTTCTTTAACCGTGGATGCAGGAAGAGGCAATCCAGCAGCTGCAAGGTCTTGGAATTGATGTATTTGAGCCAACG
CAGAACGAAAACAGTTTAACCTGGGACAGTTTGGTACATCACGGTTATGTATTGTCTTCTTTGGGAACGTTTTCACTGATTGTGGCTGGTGTATAGGCTG
GATACGAGAAGGTAAAACTCGAGATAGAAGACACCGTTGTGCTGGCACTTCAAAACCCTGAGTTGTACGAGCGGATTGCTCAGAAAACTCGTTGCCGTTA
TGAGAGCAATCGCCCCCGTGCTGTGCTGTTTGAAGGGCCTCCAGGTACCGGCAAGACGTTAAGTGCTCGAATCATTGCCCAACAGGCTGGAATCCCCATG
ATTCATATCCCAATCGAGAGTGTAGTGTCCAAGTGGTACGGGGACAGTGAGAAGAAAATGTCGGCAATCTTTGACGCGTGTGAGAAGCTTGATGGCGCCA
TTATTTTCATTGACGAGGTACGTTATCACCAGCGTTTTGAATTTCGAAGTACTACTGAACTACTACGAAGTATGCGGTACTTACAAACGTTGCTCTGTTT
GTGGTAGATTGATGCACTTGCTGGGGACCGTTCTGGCGGCACAATGCACGAAGCTTCGCGAAGAATTTTGTCAGTTCTTCTGCAAAAGGTGGAGGGGTTT
GCCTCTGCCAAAAAAACCACGGTTGTGTGTGCGACGAACCGGTACGTACAAGTTTGTTTGTTCTTGTATCTCTTTTGATATGCTGCATGGACTAACCTGA
TGATGTAAATTGTTGAACTTACAGGAAGCAAGATCTGGATGCCGCATTGATCAGCCGTTTTGATCTTTCCATTCGTTACAATCTACCAGACGAGAAGACC
CGCCGCGCAGTGTTTGCCCGGTATGTACTACACATACTCGAAGATGCGTAAGTATGGCTAGAGTTCTGACGTTGAGCGTTCTTTTAGTTATGCTAAACAG
CTCTCCGCAGAGGAACTCTCGCAGTTGGCAGCCGTGTCACCTCAGCTCTCGTGCCGAGATATCAAGGAGGTACGTTGTCAAAACTGGCTGCTAGTGAAAT
GGTCTTGTCTACTGAAGTATTGATTTTTCGAACAGATTTGTGAATATGCAGAACGCAAGTGGGCCTCGAAGGTACTGAAGAAAGAAGAAACGACAGAACT
GCCGACTCTACAAACATATATGGAGGCCGTGAAAACGCACATGGGTGGGCTATCGAGTCACGACTCACACCCTGATGTGTACGAGGCATGACTGATGTAC
CATTGGGGGTGAGAACTCAACCAGTTTGCCTAAGCTAAATGTAATCAGGCATTGGCCTCGAGATTCGCTTGTGTCGAGCTGGCGCTCAATCTTAGTAGAT
CCTGGTACTGCTGATCGAGCATATTGCCCATTTTGTCTACGAGTGGTTTGCTGTGCTCTACACAACCCAGCGACACATTATTATGAGCATTATGGGATGT
CGAGGGGCAATATGAATCCTCACTTACGCATGATAATCTGAGCAACCTTCATGAACTGCAATGCATCGTCGGTGTCATTAGCACGGCAGCAGAGGACACC
CTAGCCGTGTAGATTAGTAGAGAACAAAAGGCAGATTCGAATGGTTCATCTAAAGGTACTTACGGTGTTCCACGCCTTCGCGACAAACCATTCCAGGTCG
GGCTCAGAAAAAACAATATCCAAGCTGTCCATCAACTGAATTAGTTGTTCAAACCACTCGTGTGCTTTTGTCTTCGTTTCTGCCAGCGTAATAAGCCGTC
GCAGCAGATAGCCCAGCTGGCTAGGGTCCGTTGAGTTTTCTTGTGCCAGCTTTTGAAGCCTGCAACATTTTCGCTGTAAGTGAATGCCCCATACCGAAGA
TTTACGTCGCATACCCATAACTGAAAATGTCCCCAGCTAAGGACTGATAGCTGTCTCGAACCTGATCAAATACTCCATTTTAGCATGGTGGGGTACGAAA
AATCGAAAAAGTCTCACCTCTGACGCTTCAGTGAACTTTGCTGCATACACCACTAGCTCTACAGAGCAATTCACACATCAGTGGCATCGTTACGTATAGA
ACTAACGACAGTCACGCACCGCCAATCTCAGTGAGCTCAGAAGCACTATACTGTGTTGCCTTGCACAAATCTAAGATCGCCTTTGTGTCTGAGTCAAATA
GCCTCAACTTCACCGCAATCACTGCCGTCGCCTGAAACACCACAAGCAATCAGTGTCCATAGTTGTAAAGAGCACGCGATATGTATACCAAGTAACTCGT
GAATTCAGCAGCAACAGACGTATCTCCGCTTTCAATGTGTCCGATCCGGCTGATCACTTCGAGCACCTCCAAGAGCTGGTTTTTATCCAGTAAATCAATT
TTCTTCATGTCAGCACTAACTGCAGCCAGCAAGCATTGCTGACATCTCTGCTTGAGTGGAGAATCTTCTCCATATAATACGTCGCTCTGTTCTGCAATAG
CGGCGGCCACGATAAAGTATTTAGAGTCTTCAGTGCTTTTGGCAATGTCAAAGCTGTGGTAAAAAACGTTTTCGTTAATTTTGCTGTCATGTAGACAATT
GGTACACCGCACACAAACCTCATTCGAAAGAACCATTCGAAGACTGAAGAAGGTCCAAACCTCTCCTTGTAGTGGACTGTATCTCGCCTTGCTGACTGCA
GCAACAATGTGTTGGCATACGCCAAGAATTTTTCGCCGTATGAAGCTTCAGAATTGTCGCTTGCTTCAGCATGCTGCTGGGTGAACTTGTCAAATACAAG
TTGAGCAGCATTTTGCAGGACTATGGCCACAGGAAACGCTGCCGAGCAATCATCAGTTTGTGTGAGCTCATCCAGAATGTGTAGCACGATATTTTGCCTC
GATTGGCCATGGTTGCTGGCCACTTTCCCCATAGCCAGCAAGTCCTCAACCTCAAAATCGCCTCTGGCTTTTAGCTGCTCAATGATGTGGACTAGCTCAT
CTTCTGAGGCGTCCAAATCTGCTTCAAGTGTCACTTGAAACAGACTAAACACAGACTGCTTTGAAGCCTCCATAGCAAAAGCCTTTTTAGCCCAGTCTAA
CGCTTCGGGTTTACGACCCAGCTGGAGACACGAGCGAGCCATGATCCTACAGTATATCAATGCGGTCAAAACTGAGATGTAGATAACTTAAATAACGAAG
GCATTATTACCTCATGTACATCGCCTTATCTTGTGGTGTTGATGCCACTGCCAAGCCGGCATCCCCCCACTTCAAACAGTCCTGCATCAGCTGTGTCAGT
TTATGTCACTGTAGCAGCTTTTGTACTTTGCAAATTACCTCGTGTAGGTTTGCGTTCACAGCATTTTGAAGGCCATCGAAGATTGTCTGTCGTACTCGAA
GGATGTGTCTGCTGCTATCAGCAGGTTGACCACCACTGTGAACGTGTAAGTGCGCGGGCCATCTCTCTGTTATAAAATTCATCGATACGCACCGCCCCAT
TTCCAACAAAGCGCATCCTATACGCTTAAGCTCATTCATCGCTTCATATTGTTTGTCGTCAACAAAGGCGAGGCTGCACGCGACATCCAAATTAATGGCG
AATTCGGCGTCCCCGTAATTGTCTGCAAGCTCTCGGTAAATATCCAAACCAGAGTCAGAGAAGCCAAACCCTTGGGCAAACGCACGAGCACCCATAAGGG
AGTCCTCAAAGTTATCCTGTTCGAATAGCAGCTGAAGCAAGCGATGCGCTTTTTCAAGCTGCCTGTTATCGATGTAAAGCTTGCTCATGAGCAGCAACAA
CTTTGAGTCTTGGTTAGCTGGGATAAGCTGGTAGCACGTTTCTGCTCGGTCAAGGTCTCCAGTCGCACACAAAGAGCGCAGCAAGTTCACTAGTACATGC
TGTTTGAACGATGTCACCTTCTCTGGGAGATTGTCATCTGCATCACTTTCTAGTGAATCACCGATACGCAGAGCTTCTTCTGTGAGCTCTACTAACAACT
CATGATAGGCCACTTGACTGTATCCATCGCTCACGCTCTTCATAAGGTCCAGCAAACTGCTTGTATACGCAGTCTTGTACGGAGCCAACATTTTCAATTC
ATGCAGCGATGACAAGATATCTCGAAATTCTTCAGATGAATTGTCGGAGTGATCTGCCACCAGCTGAAGTACCCGCACTCGATCTGCACAAAAATCCCAC
AAATCATCCACGACGTGCTCCAACTCCAATCCGTGCTTAAATTTGGTTAGATGAGAGAGCCCAATTCGAGACCAGAGCTGCATCGAAGAAGAAAAAGCTT
CTTTTGCCATCGCCAAGTATTCGTCGCACTTCTCACAGTCGACTGACGCGCTCTCCAACATTAACATGCCCACTCGGCCAAAAGAACGCAGAACGTCGAC
ACATTCGTCCATGAACTGCATACTCTTGTTCTCTCCTTTCTCCTGTTTCTCGCTGTCTTTGGAACAAATCAGCGACAGCCCCATGATCTTCGCCGCTACG
AGACGCGTGACGGCTAGCAAATACCGTGGAAAACTTGTGCGCTGCTCGTTCCCTTGTTGTCTAGCCGTCTCCACTTGTGCCAGAACACTTAGAGCAGCTC
TAGGAGCGTTGTACAGCTCCACTCCAGCATTCACCAGCTGCACACCAGATAACTCCAGGACCCTTTGTGAACCAAACGCACCAACAGCGCGTTGAAGTTC
CTCCAACAATTCGTGTAAGGCTGACACGTCCTCCGTTGAGGCTTCGGCTGCGCGTCCGAGAAGCTCCGTCGCTCTCTCCACGCACTTCAAGATCGTCGAT
GCGCCTTCATCCTGCATCTTCGGGTTGCTTGCTCTCTACGCGGTGAATTCCGCACTGAGGCTCACAATACAATCACTCCTGCTTCAGCTTCAACGACCTG
CTATATTTGATTTATCGATGTAAAGATTTAAGTAGAAATCAATTACTGTTGGGAAACCTGTGAAAACGCATTATTGAAATTGGCCACGCAAGCATAAGAT
GCAAGTCAGGTGCTTGTTCGCCGGTGCGGTCGCCGCCGTAGCCCTGAGTAGCACTCTGTGTGAAGCTGCACCGAAGGTCAACATCAAGATTATCCCCCGT
CCGCGACTGGGAGAGGAGGATTCGTCACTATTGGCTCCCATTCCGTCCCGTGATCCATTTCCGGCATTCCAAGGTAGGCATCGATTACACGAAAGATAAA
TATTGGTGTATATACAATAATTGTATGCAAATTACGAATTCCAGGTCCATTTGTTGACAACCTCGAATCACTAGCTTGTATCCGTGAGGAACGGGAGATG
CAGGAGGGTAAAGCGTAAGTGTTACCAGTTGTTTTTCAGCATTTTTTTCGTTTGGACTCCTCGTCTAACCTTGTTATTAGCTATATCTTGGACTTGTGTC
TTTTAAACAATGTGACAATTGAAGCCAAGATCGATGAGAAGGTTGAAGTGGAGCTGGAAGTGATGGACGGTGTGTCTGAAGCTGCCAGCATAGAGGATGG
CGATGAAGCTAGTGCGAAGCTTGAAGACCCAGTGTCTGAGGAAAAGGAGGAGCCGGAGGTCCCTACTATTCTCGGGTAAATTTGTTGAGCTTGGGTTCTT
CGCTCATGATCCTTTCTGATGCATTACTGTGCTGCTTGACACATTTGCAGCATCTTCCGTGGATGGCAGATCGATCCGATCACGCTGAATTACAAGTACA
TGGTTTACGACGACGGCGACGATTGCATGGACAATGATCATTACTCCATGGTTGTGGAACTAATTCCCTCCAGTAACCCGGAGTCGGAGACGAAGCTGTA
CGGACTGAAGAAAACGGGAATGTGCACGTTCAAGGCATCCCTGCTTACTTACGTACCCGAGGGAGACCGTCTTGCAGGAGAAGGTATCCACACACCTGGT
GTGGTGGATATTAGTGATGCGGAGGCATCCTTGCCGGTGGTCTGCGGTAAAATGAAGTGCCGCTATGGGGATATTTCGAAGCGAGTGCGAGATTTGTCAG
ACCAGGTACGATGCAAGCTCAAAACACTTTGGGGGGATTCTACGCTGATACATTTGAATGCTCTTGTTCTATAGATTCGTGCCGTTCAGGCCACGATGAC
AAAGGGATCTTTTAATGCAAACACGCTGTTTACCAACATGACTCTGGAAGCATCCAAGAACACGCTTGAGTCAGCTACGCAAATTCTTGAGAAGTCACTC
GAGCTTTTTCATGATATTGAGGACCTGCAGCAGTCCTTAACGAACGATTTTCTTGGACGCGAAGAAGCAGCTAAGAAGGAGATTGCGGAGCAAGAAGCAG
AAGACAAAAAGAGACAAGAAGAGAAGAAAGTCCAGCAAGCCGCCCCTGTTACTGATAAAACTGCCGAAGAGGAGACCGTCGATAATGTGGTTGAAGAGCA
GGATCGAGTGACGGCAGAGAGCTGATCTGCAAGTCTTTAAAGCGGCGGAATACAAGACTTCTCACGGTGCCAGTCTGTCGAGGTTTGTTTACTGATCGAT
GCAATGGTTTCTAATCCAGATCCAGCCAAAAAAAGAAGGCAGCACTCCAATATCGTGCTGTCGCCGTCGAAATGCAAAACTCAGGGCCGTGGTCATGGGG
TGATTCGTGCTCACAACTACGACCGAACGGAGAGAAAGAACATGCACTCTCACGTCGCCGAGAAGCCTTGATGGATGAGTTCTTGCGAATACGTCGCCAT
CAATTGAATGATGCTCGAAGAGAGCGCCGGGACAAACTGAAGTATCACATTATCCCTATGCGCTGCTCCTTTTGAAGGCAACCCTTAATTTTGTTTTGTG
TTGCAGCGCTCAAGTGCAGATGCTTGAGCAGCAAGTACGCCGTTACGAGGTGGGTTCGCGGTGAAGCATGGTCGTAGCACGGAGATATGTCTAACAGTTT
ATAGCTTACGGTGTCTGGAACAGAAAGTATTAGCCCTGTTGTCAGCAACAATCCCTGGACCAAGTCTTCGTTGCTTACCTCACAATTTGACCGATTACCG
GGCTCAAACGACAATTTGATAGAGAGGTTGGTTGAACAAAACGAACAAATTGTGGCGCTATTTCTCTCCGGGCAGCGGTAAGTGCCCTTGCCTTATATTG
GTAGATCGTGTGCCAAGCTAACCTCTACTGTCCAATGCTCAAAGTGAAGACGCGCACGTTTTGGGTGCTCGGAATGCAGAGGTCTCCGGACAATCGCTGG
AATTTTTTCCTAGTGAGTCACGAGATAATAGGGACCATTCCTCATCAAACCAAAAAGACAACGACGAGAAGTTAAAAAGTTCACCACAGCACGAGAACCA
CAGCGAAAAACCAGCGAGGAATGTTGTTTCAACAATCCAAAGCCCGGCTACTCTCTCCTGGTTCCCTGACTTCGAGTGGACAGATGAAGATGAGCTGGTA
CGCATAATTGTTGCTAATTCACGTCACATGCTGCTAACGTAGACTGGTTTTCTTAGGCTCTCAACAAATTCGAAAACGACACTGGTACTTTTCCTGATCT
TCCGGAAAGTGAGAGTAGCAATCCACAGGGCACAGGTATTTCTACCATGGACACAGCAGCCACGTCAAAAGACCAGAAAGCACGTGATCGCCTCGAGAGC
CGTAAGAAGTTGGAGGCACTACTCAGTGCCTCGCTCAAAAATGCTGGAGGGGGCGTCTTAAAAAAACCACGATGGCGTCTTGACGCCGAGGCTGATAGCG
ATGATGTCTCGGACTTCACTGAGCATGCAGAGGCCATGAAGCCTCTCCAGGTCTTCCGCTCTGCCATTTTAACAGTCTTACACACTATCTACCTCAAGAA
TATGCTGATGGAGAAAAAGCTGGCAGAAAAGGAAAGCGCAACGCGGGTACGTTTGTGGTTTGCGAGTTTTGTTTTGGTACTAGTTGAGCCACTCCGGTGG
CAAGATGGCTCGCGAAACGCGTTTACATACATGCATACTAACTAGCCGCATCTATCTGTAGGACTTTGAGTCCATGTTGCGTGTTTACTTTGATGCCACT
CGCTTGTGGCTAGGAAAGGTGGTAAGGACTCCACTGTTGTCTCTCCTTCAAGATTCAAGTTTGGACTTAGATATTAGCACTAAAACAGGTCTTGCCGGGT
CATCTCTACGAGGTTTTGCTAAGAAGTTTGGCGGTATCCTTGCTCGCCGTCCTCTCCATAACAATGAGCAACCAAGTGAGAGTCTCGTGGATCCAGCGAA
GCTGCTTAAGCTGAAAGTTCGTATGAAAGGAATTCTACAGGCTCTAAGCAAGGCTATTGACAGGAAAGAGGTGCCTTCCGGGATTTTGGACTTCTGGAAA
AGGATTTCTACCGATGGCGTTTACTTTCCGTCCAGTGTAAGTTAGAAAACTGCTGCTACTTGACGTGCTGCTAACCAATTGTTATGCTTTCCAACAGTAC
CAATTGTTCAATGAGGAACGTCGAAGTCTAGAATTTGATTCTCTCGGTGCAACTCGGAGAATGGACTTTAAAGGACCTATCCTAGCTGACGTGAAAGAGA
AGGAATGGAGTGATGAAGCGGGTCCACAAGATGTCAAGTGTTTCTCTCGGTTCAACATCGTTATGATAAATTTCCTGTTCGCGCGGATTCTGATTCCACA
CGTCATCTTGCAGCCGTGGAGCGTTGGCATCGGATCTAAAAACATTGGAAAACAGGTATCAGCAAATCTGGCCAGCTTAGCGACGTTGTGCTACTGTGTC
TGCAGGCAGCTCTCGCCATTGCCACCACCAGTGGAGCGTCCAGAGGCTTCGTTTCTAGGGAGGCGGCGTTCGAAAGTGCTAGTACCAGTAATCTCACAGC
CAAGTACAAGTGATAACAGACCAGATTCCAGCGAACCTAATCCAGCAACTATTCCATCGGAACGGGAGGAAGAGCACCCTGCGGATATTTCGTTTCTCTC
CATCGAAGAAATTGGACATCGTCTCATATCCGACAGGCTCTTCCCCTGTAACGATGCTCAGGTCATCCAAGCTGTGAAAGAACATCACATAGCTCTGCTT
GAAACGATGGCACATCTTCGATCTCAGCTCCACGTCCAGGAGAATAGCACGATCCAATAATTATCGAGCAAAATATGCCTTCTTGTTTAAACTTAAGGCT
AGCACGATAAGCCGTGCCAGCCTCTACCCTTGCAAATAGTATTTTACATGGTGTTCTGGCTGAGAATTCCCGAGTCTACTGCGATCTACTTGAAGTATGT
GCCATACACCGTTGTCCCATAGCCCCCTTAATTATTGCGCAGCCAGTTCGTTAGCGCGTACTCCTGACGCTCGTTGTCGCCAACGCGTTGCTGCTGACTC
GACGCCCTTGGTTGTGAGTTCAGCAGGTTCAGCATGCTTGGAATTGGCTTCTTCCGAGGTATCGACCGCGAATCGTCTTCTTTTGGGAGGAAAAAGTTAG
TCAACTTACCGGTTTCGTCGTACCCGCGGCGGCATACTGCAGCCTCAGATCCCACCATCTGCACTGGAGGCTGGCTCGACGGTGTCATGTTGAAGGCCCC
GTACTGGTTTGGGTTGTAGGTACTGCGTCCAAATGTCTGCCTTGCGCTCGGTGGCGGGCGGATTGACACGTCCGAGTAAGCGTTCGAACGGAATCCCGCC
GACTCTGAGCGAGGCGTGAATCCCAAGCCACCGTCGTCGTCTTGGTCAAAGAAAACAACCCCGCTCGATGGCATAGCCGATGACTCGATTTTACGTTTCT
TGGTCTCTACGGGCGGCTGAAGTCCCGTTCCAAAACTCGGGTAGGCACGTTTTCCTTCAAATGACGCGGGCCCTGAGCTCCGAGCCTTGTTCTTCGCCAT
TCTAGCATTGCTTCCCGACTGTTGTGCAGTTTGTGACTGTTTATTGCTCAGCATCTCTTTGAGCCGCGTCTTCTCCTTCACCACCTTTTGATACTGATCA
TGTCGGAACTTGCACGCCTTCTTGAGCGCCATAATAAGTTCTCGGGGATTCTGGATCTCCTCTTCCAGTGCAGAGGCATCACAAGTCTCTAGAAAATTAA
TGATGCTCTGGTTCACGTTGGCTCTGCGTGCAGCTTCCGTTTGACGTGACAGTTCCAACTGGTACCTCGCCACTTTGTTCAATAAGTCGTTCTTCCCGGC
CTGTAAACCCCCTACACGCTGTGCCAGTGTCTGCTTATCGGCCAATAGCTGCTCACTCTGGCTACGAAGACGCCTTAGCTCGTCAACAAGTCGCTCCTGC
TGCTTGTTCTGCCACTGGATACGCTCCATGAGCGTGTTGATGCGCGAACTTAGCGCCACATTGTCTCCGGACGCCTTGGGAAGCTGTAGATCTCCTTCTG
GTACCTCATTAGCGCTTGGTACATCGAAATAAAGCGTAATTAGGTCGGTTTCTCCCGTACGACTGCGGCAAATGGGGCACTGGGTGTTGACCTGCAGAGC
TTGAATGATGCAGATGTGGTGGAAGACGTGGCCGCACGGAGCAGCCACCAGGTCACGGCGTAGCTCCTCCAGACAGATGTGGCATTCCTGGTTCGCCATC
ACCTTCTTCCTCTATGATCTCAATTGTATATGGCGTTTCTTTTCCGACTTGAAAAATACCTTTTCATACTGAAATCAAGTGAGTCCAAAACCTGACAACA
ACTCGTATTTCACGGTGCGCAAACATGGAGTACACAAACACAAACTCGTAAATACCTCGTTATTTCGTAAAAAGATCCGTAAAAAGACCTCTTTTTGAGC
CCGCCGCCGCCAATCGATGACCGTGACAGGCGCTTTGTATGGTGCGCAGCCTCCGCCTGTTGTAAGCTCTGCCAGTGCTTCTTAGTTAAGTTTAGAAGAC
CAACGCAACAAAATGGTACGCGGCCCGTGGCTTTTGATACGTCCTATAGAGCAGCCCACAGGGAAGCAGCAGCGCAGACAGCTAACGTGTCGTGTCGTGC
CTTGACTTGCGCCCCACACAGCCGAAGCAGATCACCGACATTCGTGACTTCCTGCAGAAGGCGCGCCGAAAAGATGCACGCTCGGTGAAGATCAAAAAGA
GCGACAAGGTCGTCAAGTTCAAAATCCGCTGCTCGAAGTACCTGTACACGCTCTGCGTGACGGACACGGAGAAGGCGGACAAGCTCACGCAGTCCCTGCC
CCCTGGTATGCCCGATTGTGCTTGTTTGCAGCTCAAGAATGCCACTGATGTTTTTTACTTTTTTTCGTGTGATACAGGACTCCAGCGCAAGGATATTTAG
GTGTGGCAACGTGCAAGTGCGGCGCATAATAAAGCTCGGTCTTCTTAAGCTTTTTCAGCGTTGGAGGCAGGTGGTAGGTTCGATGCAGACGAAGATCAGC
AGAGGACTGGCCTGCAGGGCACAGCAGGGGTGTTTCTCGTAACAGCTTCCTCCTTTACTCCGCTCGCTCATTTGACGGACGGACGCAGAGGGGAACCGGG
GGCGACACAAATATCATCACCTTCATCCACAGGTTACAGCTCTTTGTTGGGCAGGACCAGTTGGTCCTGTTACTTCTGATTCCGCTCGTAGAATTGTTCG
TGTTTGCAGGGAATTCGCCTGTGTTTCAGCCATACAGGGTTTCCGGTCGACAAGCCGCTATTCCGACTTGATGGAAGTTGGTCTACGCATTTGGTTCACG
GATACAACGCTTAATGCGATAAGTTGTGGGGCTTAGATCCTCTACAGTCGCGACTTGCTAGCACGTTGTACTTGTACAACAGCTATAGACTCGTTTGTTG
CGAGGTGTTCGTGCCATGCAAGAATAACGCCAACAAAAGTAAAAAAAAACACAGGAAGCTTTTGCCTTCGTTTAAGAGGTTAACGTGCTTGCACCTTCGA
CGCTCGGCAACAAACAAAGCAGCTCGACCTGCAACGTCAGTAGTCAAAGACCATCTTAGTGACGAATGAGCAGGCCCTCCACCTTCTTCAGTCCACATCA
GCTTAAGCCGAGTTCTTGCGCTCGGGCGAGCGAGCAGCAGGCGAGGCCGATCTGGAGCGCGAACGGCGCGGGGAGTCCTTGCGCGCTTCAGGCGAACGCG
AACGCGAGCGACGGCTCGGCGAACGGCCACGGGCAGGCGAACGAGAGCGCGAGCGGCGGCTCGAGTCTCCCTCGGGGGCAACGCGCACATAGCTGCCACG
GAACTCCGTGTCGTCCAGCTTCTTCACAGCGTCTTCCATGTCGTCCTTGGTCGAGAACTCGGCGATGCTACATTATGGATAGCAAAACACGTGCACAAAG
TCAGAATAGTGGCTCGAGATCTAGACAACGACTGAAGTACTTACGCGGAGCCATCAGCCTCGATGTTGCAGTAGGTGACTTCGCCACCCGTGCGGAGGAA
GTCCTTAACGTTACGCCAGTCGACATCACGCGGCAGGTCCGTCACGCGCACACGGAAGTCAGTGCGCTGGGGCGGGTTGCGTCCTAAATACCAATCAATC
ACAAAATGTAAGTCACAGACAAAGAAAAACTATCCAAGGTGACAACTAACCACGTTCGAAACGGTCGCCACCACCGCCGCCGCCGCCACCACGTCCGTAG
CGGTCGTCGTCACCACCACGACGGCCACCACCACCACCCTCGCGGCGGTTGCCACCACGAGCGAGCTCGACACGAATGCTACCACACGGAATACACATAA
CGTCAGACCCTACGTAGTAACAAAACATTCAATTATCAGATCTTACCGTCCACCAAGGAAGTCGCGGCCGTCCATAGAGCGAATGGCATCGTCAGCGTCA
CGCGGGTCTTCGAAGTCCTAGAAGAGGTGGAGGAGCAGGAAATGGGGAGGACGACGATGGAGAGGCGTTGGTTGGTATGGTTCGGATCGGAGCAGGCGAA
GAAGATGATGCAGGTGATGGCGGAACGAAGCGAGGCGAGACGCATGATGGCACGTGCGTTGCGAACCCATAAATAGGAGACTTCTCTATCTCCCTCTCCA
ACAGAAGGAAGTGCTGAAGACGGCGAACGCCCCATAGAAGTAGCAGCACAATGAAGACGTCACGGATCCGGAAGGAGCTCACAGCAGGTCAAGTGGCATA
TGTATACACAAATGTATAGTATACAGAAATACAATAAACACACAAATTGCCACCGAATTGACCGCCACACTCCTGCTTGGACGACAGAGACGACTAAAAG
GAGGGAGAGGGAGGAAACGCGCCATCATGCGAGCGAAGCTTGTGCCAGAAGACGGAAGAAGCAGCTCAACTCACCACGAAAGCGAAGCCCGGCGGGTTGC
GCGCCACCCAGATGTTAGAGACGTGTCCGTAGCGGTTGAAGCCGTCCTGGATCTCGCGAGACGTGGCGTCGCGCGGGAGTCCGCCCACGTACACACGAGT
GCCCATCTTGTTCTGGTTTAAAAGGTCTGGGAAGAAGGGGGAAGCGAGGTCTGCGCCTAAGCGTTGCTTGGTGCGGACTGGAGCTCTTCGGTTTGTGACC
AAGAAGAGGGCCAAGAACAGCTGAAGAATTATGACTTTCTATTGGTCATTATTCATACCCTGTTTCTGATCGGTTGGTTTCGCGCTGGTTGGTGTACGTC
ACACCAGGTATTTGGCTCGCCAGCACTGCCGCACATTCCGGTTGTAAGATGCTGTCAACTGCTGCTCGTCGCCTTCCACGCGCGGCTGTGGCGCGTCGTG
TCGCCATATCTGCAGCTCATCAGCGTGTTCCTCGTGTGGCTGGCGCTGCACCACAGACCCGTGCGTTCTTAGGGCTCCGTGATTGGTTGTTCGGTGGCAG
CAAGCCGTCCAGTGAGGAGCAAGAGGTCGCTAAGACGCCGCTGAAGACTGAAGAGCCTGTAGAGGATCAGAATAAGACCCAACAGCCCAAGAAGGAGAAG
GAGCGTGTGGTCGGAAGCTTGGATACCACGTCTTACGCTGTGGGTAAGCTCGCCAAGCTCGCAGATGGAGCTGTGCTGGCCTCTTGCGGACGTACGGTGC
TGCTTACGACCACTGTGAGCGGAGACCGCAACGGAAACCCATCAGCCAGTGGAAGATCAGGGCAGAACGATTTCCTGCCGCTCACTGTGGACTTCCGCGT
CAAATCTTACGCTGTTGGTCTGATTCCGGACAACCAGAAGCGACGGGAGTTCACTGGCAGTGATGAAGAAGTGCTGCAGTCCCGTGTGGTGGACCGTGCT
ATCCGTCCACTTTTCCCACGTGACTTTTGCGAAGATACGCAGGTGCTGGCGACTGTGCAGTCGTATGATCCTAATAATGATCCACTTGTGGTGGCGGTTA
ACTCGGCGTCCGCGGCGCTGAGCATGTCCGACATCCCGTGGAACGGACCGGTTGGCTGTGTGCGTGTCGTGGAGGTGGATGGACAACTGGTGGTCAACCC
TACTGCCCCACAGCGCGAAGCCGCAACGCTGGATGTACTCTACGCGGGCACGGCGGAGCGTACCATTATGGTGGAAGCCTCGGGTGACGAGGTGACGGAG
GCGCGTCTCGATGAGGCGCTGGATCTGGCGCACTCTAATGTACTGCCAGTGATTGAGGAGCAGACAAAGCTGGTGGCTGAACATGGAAAGGAGAAGCGTG
CGTACTCGCCGATGGCCATTCCGCCGGAAGTCTGGGCCAAGGCTGAAGAACTGGGTCGCACCGACGCTGAGGCGTTGATTGCTAGCTGTCGCGTTGGTAA
ACTCGACCGTCAGCAGGGAGAGCGTGAAGTCTACAATAAGATGCTCAGCGGTATGCGTGAGCACTTTGCTGCTGCGGATCCTCCCGTGAACGATGCGGTT
ATTCAGCGTGCAGCCCACGACACGTTCCAGCGTGTGCTGCGTGATAGTATTTTGACTGTGGCAAAGACAGCTCAGAAGAACAAACGTGTACGCCTCGACG
GCCGATCGGTTCGCGTCGTGCGTCCACTGGAGATGGAGGCTAGTATTCTGCCCATGGCTCATGGATCTTCCCTTTTCGCTCGTGGTGAGACGCAAACGCT
GTGTTCCGTGACACTGGGGCCTCTGGAGCGTGGCATCCGCCTTCGTGGTGCACTGCACGAGGCCCGTGAACAGGATGAACCTGCACAGTTCAAGAATGCT
ATGCTGCACTACGAGTTCCCCCCGTTCTGTGTGAATGAGACCGGTCGCGTTGGTGGCACTAGCCGGCGCATGATCGGCCATGGGGCGTTGGCTGAGAAGG
CCGTGCTGCCTATTCTGCCGTCCATCACTGAATTTCCCTACACTGTCCGCATGACTTCGGAGGTGGTGGGCTCAGATGGATCGTCGTCCATGGCTACGGT
ATGTGGCGTTTCCCTTGCTCTGATGGATGCCGGTGTTCCTGTTCGCCGTGCTGTTGCAGGCATCGCCATTGGTCTTGTTACTTCAGGCGATCCGTTTGCT
GGTCAGGAGAAGCAAATTGAGGAGGGCGACTACCAATTGATCACTGACATTCTTGGATCGGAGGACCACTACGGTGACATGGACTTTAAGGTGGCAGGAA
CCACCTCGGGTGTCACGGCGCTGCAACTGGATGTGAAGCTTCCTGGAGGCGTGCCGCTTTCCGTTCTGAAGGAGGGACTGCGCGAAGCTAAGCATGCCCG
CCTACATGTGCTGCGTCGCATGAGCAGCGAGCTCGCTGAGCCTCGCGCGAGTTTAAAGACCGGTGGCAGTGCGCTGCCGAACGTGAGTATTGAGTGCGTG
ATTGCCACGAACCTTATTGGCGCGCTTATTGGTGTGGGAGGTAGCAACATTCGCGACCTGGAATCGCGCTTCAACGTTTCGGTGAGTATCGTTGACCGTC
GCGAGGGAATTGTTCGTGTCGTTGGTGCAGCTGGCGATACTGAGAAGACTAGGGACTGGCTGCAGACCGAACTGGCTGCTGTTGCGAACAAACGCCATGA
CAATGGTGACGGCAACGACAACAACAGTCGTGATAATGACCAGCAAAACTCCAACTCCCACAAGGGCCGGTCGTTCTTCTTCCGAAAGGGCGAGCGCTAC
ACCATGCGTGTCACGCAGATCATGGATTTCGGAGCCATCCTAGAGTCGTCGGATGGTCAACGTGGTTTCGTGCACATTTCGGAACTCTCTCGTGACAAGG
TCAGTAACATTCATGACGTAGTATTGGAGGGACAGGAGATGGAGTTCGAGTGTCTGCAGGACGGAGCTTCCGGCAAGATGTCACGCCGTGTACTGCTGGG
TTCGGGTGATAACGAGGAAGCCTCAACGGATTCCTCCGAGACCTCTGAGTCCACGACCTCGCGCGCTGGCCACCACCACGCGCGTCGATCGTCATCAGCT
TCTGGTGCGGCAAAGCGCCGTCCCAAGACTACACGCCGCCCGCGTACTCAGTCAAAATAGGTAGTCGCTGCTGAAGAAGGTGAAGCTATCTCCTTCTTCT
TGTGTTAGAGCTCACTCGGTAACCAGAAACAAGAGAAACATTTGAACCGAAAGTCACCAAAAGCATGCAAAATGCAGTAGAATATGAATGCAGCCCTAAG
TGGTCTTGACTGTTAAATCTACGCGTTTACCTCTGCCAAGACTGCGGTGGCTTTATCGTCGGGAATTTCGTCAACCTCTTCATGTTTCATGGAGGCTTGA
AACGCGTCTAGATGCTTGTCAAGACGTGCCTCCCTATTGTCAAGGCGTTTCTGGTTCAATGAGTCCACCCCAGAGTCTGATCCTAAACCAGATCCAATAC
TCCCGATGTCTGTCGGCAACCCATTGTCAAGCATGCCCAGTACCGCTGCAGGAGCTTCAACGACATTGGTGATTGAGCCAACGATGAGGTCGAGAATATC
GCCAGCACTGCTGATATCAAACTTCAATATCACTTTGGCGAGTTTTAGTGCAACGATTATCAGCAGCACCGACCACGCCCAGAAGATGCGCGTTATCCGC
TCGCAGTACGATTCGGTAACAATGGCGTGCGTGATGTACTGCTTGATGAACGGCGCTGCAGTGTGGACTTCTTCCAGCAAGTTGTTGTGGTGCAATTTGT
TTCTGCGCACAAATTCATTCCAAACCAACTGTTGTCCCCGTTCGGTCTTGTTGATGGTTCTCTCCAAGTCGTTCATTCTGGAGTCAGTGAAGTAGTAAGT
GCCATCCTTGACCATCGTGTTGATGCAGCGCACAATGGCGTTGACTCGCAAGTTGACTTTAGCAGCAACTTTCTGTTCCCAATCCGCTTTCTTGCGATCG
CCTTCGCCTCGAGAAAACCATCGACCGTTCTTGGCGACCACATCGCCAAGTTTGTAGGCATCCCGCGCACCCCAGCAGAAGATCGCACCAATGTACCTAT
CCCGAAGTCTCTCGAACTGTTTTGCGTGCCTTTTATCGATTGCTGCCATGGATCGCTGGAGTACTCCAACCACCTTTTTCTGTTTCTCGATGGACTGCAA
CTTCAATATTTCTTCCACCGCACGCACGTCCGTCAGTTTGTGAGCAATTCCGTGCATCTGTATCTGCATTTCTGCTATCGCTTTCTTCGCCTTCTTGATT
TCTTCACTCGTGAATCCCTTTCGTTTCATCCAGCAGTAAAACTGAGACCGGGTCACAACGGGGTCTTCTTTATCGAGTCGACATGACACCACGAAAGCCT
TAATACCGCTTATACAGTAGGCAATAAACTTGAAGGGGGCCAGGATGATCCACGCGATAAGCTTAAAGAGAAGCGTTATCGGCAGGAAGATGGTGTACAT
GTAAGACGGGCACTCAGCTTCTTCTTCGACCCGCGGTCGTGGGTATACGCGGCGATCTTCCGTCCAGTATGAAGTCCACTCGGGTTTGAACGTGACAGGT
AGCTGCTTCATGAATTTGCCGCGGCAGGTATGCACCTTTCTAAACGTGTACGACTTGGGGGTGTCTTCTTTAACAGAAACTGCGACATCGACAGGAGTCA
CGATACTCATTCTTCCACCACTCCAAGTGTTGGAGAAATGTTTCACTGTCGCCTCGAGGGGGTTGGAGTTGGACGGGTTCTCGTCAAACTGGAAAAATGA
AGAGTGCGTTGTGAATGTCGTGGTTTCCATTAACACCTTGGGGACCTTGGAGGAGATTTCAACGTTCCCATGGCTCTGCGATTGTGACAAAGAAACAAAT
GGGAATGGTTCATGCAAAATTAGCGTTGAAGTAAAGTGTAGCCATTTATAGATGGCTACATTCGTGAATACACTGTATACATCTGTCTGCCATTCGGAAG
ACATCGATAATGACCTCCTCAGCTCCAACACCGCACCACAAATTCTCGCTGCATGGCGGGCACAGCTACCTCAAGATTGCCATGTACGCCCTGACTCACT
TGCCATTTACCATAGACCGCCAGTATCTAATCTATTGCCTACCTTCAGCTTCTCCGAAGACGGTTCTGAGCCTGTGGCGGACGTAAAGCAGCTGAAATTC
GGCCTTGACACGACTCTAAAGACGGCGTTCGGTGTGGTGGGAGCTTCAGCCAGCGAGTTTGACGTCCTGGCCTTTGACAAAAAGCCGTCCAATAGCTACG
AGCCCAGTACGGCTCTGTTGCGCGTCCAACGTGGCGGACTGGAGACTCTGCGGGGAGCCATCACCATGTGCACGACTCTCAATGGGAAACTGTGCAAGCT
GGAGGTGTTGCACATGGGAGATTCGCTCATGGACTTGGCCTCCGGAAGGTTTTTGTAGAAGATGAAGCAATACATAGAGATATAGTGAGGAAAAGGACTG
GCAAACGTTACGCATTGACACACGAGCTCGTCTATCTGTCTACACAACAGCTTCAGGTGCACCGACCACGATGGTCTTCTCGGAGAAAGCGGGGCGCTTG
CGGTTGCGCTTGAGCAACACAGTGCGGTCGATGGGGTCGTTGTGCGCGTTGAGCCTCATAGTGGGGCGGTGGTCGCCCATATTGCCGCCAGAGCTCAGTA
CGTTCTGCATGGAGGACATGCGGGAGACACTGGACGTGGCCTGCATGGCGGAGTTCAGCGACTGGACTGAGGCCGTAAATGATGGGATCGAAGGGGACGA
GCGACGCCGCCGTAGTTCTCGTCCAGTGGGCGCACGTTGGCGTGTTTGGCTGCCCTGTTCCTCTTCGTCCTCAATCCGCAGCGTGTCCAGCACTTCATCC
GTCAACGTGGCACGGTCGAACGCGTTGAGAACGAATTGGCGGAGCGCCAAACGATAGCTGTACTTCTCCAGTAACGCATGCACATACATCAGCAGCACCG
GCTCCTCGAACAGCTCCGGTTTTGATGAGCGCAGCTTGTTGAGCGAAGCATGGGCCTCCTTCTGGGTGATGTGGTTGCTCAGGTCTGCCACATAGCGTAG
GACTTCGCGCCACTCGTTGGGCATCTTGTCACGCCTGCGGATTAGCAGGCGCTGCAAGGGTGAAGCACCTGGTGTCTGCGTTAACGGACAGGGAGTTGAG
GATCCAGACGGCGGCCACATGAAGAGCGACGTGCAGTTCTGCGGAACGGCAATGGAAGTACGAGATGCGTCACGCGGGGCGTCCCAGCCAAGCCGTGCCA
GGTGCCGTCGACCAGCAGGAGATCGCGCAAGCAAGCCCAGCACAAAGAAGCAGGTTCCGCGGATGGAAACGAGCGGGGAATCAGTGGCTAGCTTCACGAT
CATGTCCACAAAGTCTTGAGCGTAGTGATTCAACAGATCGTACCCGCGTGGCGTGGCGGACACGTGACCAAGCGC