Description :
From Genome Similarity Track
Location :
Scaffold_5:98778- 100731
Transcript NameFunction/comments
Phyta_totarag388conserved hypothetical protein

Sequence
1953 bases(100 bases per row)
TCTTCAAGTGCTCGTCCTggatcagcttctccagcttcgacacATTCGCGTCCGCGTTTAGCTCATAGATGTTCTCGAAGGAGTGCTggttctcctccag
cacggtCTTCCATGCCTGGCCGCCGCACACGTTCATGCTCGAGCGCATCACAACCTTCTTGCCATCGGGCAGTAATACGCCGACGACAACGCTGCCCTCC
TCCAGGCAAAGACCATCGGCCTCGTCCGAGGTGACATTATACACCACACAGTTGGGCGCCGAGATCGAGCGTGCAGTTACATTGATCAGGATCGAGCCAT
CCGCGTTCACCTCCTTCGCGCACACGCCACTAAGCACGCTGCGTTTGATGTCACCGTGCTCGATCTCGCTGTTCAGCACCGTGGCCTCATTGATGATTGC
ATTCTGACCGACGTTGCTGTGCTCCATGTTGTTGCTAATGCCTAGGAACGAGCGCAGGCAGTCTGCCTCCACGCCCGGCTTCGTCACTAGACGGTTGTTC
TTCAGGTACAACGTCAGCTGACCGTAGTCCCACCAGTACACGTCGCTGCCAACGTCAACGCAGCCAAACAGACCGAGCTCCTTCGCCCGAGTCTCCTCGA
AGTTAGCCATCATTTTTTGCATACGCTGGTAGTGTGCAGTGGACTCCGTCTTGTCGACGCCCTTCTGCGCCATCACCTCGGTGTAGGCGTCGAGCTCAAG
CGTCAGCGGCATCCAGAAGTGCGGGTCACTGTCTAGTTTGCCAGATTTGGCAACCAATTCCTTCGAGAACTCGCTCAGCAACGCACGAAGCATGTCGGCG
TCCACGCTGAAAGATCCCAAACTGGTGCCCACTGACTTCATCTCGCCGAAGGAAGACAGCAAACGGATAGCCGTCTCGTGAGTGACCTTGTCGACCTGGG
CGGCGTTGTCCTGCTGGTTCACCACAATCAGACCGTACTTCTCGAGGCCCTTCTCCTTCCACTCCTTCTCAGTGGGCATCGGAGCAAGTGCGGCCAGGAT
GTCAATGTGGTGCTTGGCATGGTACTTGACCTCAGCCGACGGGATGAACACCTGGTCACCCCAGAAAACGGACAGACGTCCGCGGCGGCTGGACGCGTAC
ACACCAGTCTGCTTCACCACCGCCTCGAGGATGGTCATTGGCACATACTTGTCCTTGATCTCCACCATTGCCGGCAGCTTCACCCCggacttgttgttgt
tctcACTGCCAGGCAGCGGCGCGAGGCGCGTGCCCTTGCCGGCAGTGTGGTATAGCGCAACACTGATGCTGCCAGAGGCGAGCAGCGCTGGGATGTCCAT
GTCGTACAGCTCCTTACCGGCCGCCACCGCCTTGGTGTAGGCGTAGAGCGTGCCGAGGCCGTTGCCGGCGCCGCCGTCCCAGTCCTCGAACACTGCAATG
ACCTTGGCGTCCTTGGGCGAGATGGAGCCGCGCGTGGCCATGAGGCGGTCCTGCCAGTATTGCGCCTGGTGCGGCGTGGACGTGCACACAATGACGACGT
CGTAGCCGTCTAGGCggttgatctcgtcgatgTTGCGCTGGTGCGCCGTGCGAGGAACCATCGTGTCTGGCTGGGAAGGTGACGACGGAGGCTGCTTGAT
GGGCTGCGGGCGGAAGCGCAAGTGAGAAGCGTaggcggcggctgcagcggccAGCGAAAGCGCCAGCGGAGTGAAGAACTTGACCATTGGGGTGGAGTGT
GTGTTGTCGCGGGCGTTTTACGTCGTTATCGCCTGGGAAGGGAGAGGCTTGCTCGCTTCTTGATTGTCGACCGTTGCGGTACGTGGTCTCCTATTGATAG
GCTTGGTGCGGTGCGAGGCGCTTGACCAAGTCGTTCAGAGAGAAATGGGAAGTGAGCAACGAACCCGCAACCACCCGGCCGCGAGGATACACTGGAAGCT
TGTGGGCCTCCAGGAGTAGAGACGGGTGTCGACACGTATGCCCCCACGAAGCA