Description :
From Genome Similarity Track
Location :
Scaffold_14:98750- 100467
Transcript NameFunction/comments
Aphas_H257_06117Hypothetical protein

Sequence
1717 bases(100 bases per row)
GAAGGTGTGTTGGTCGCTCAGAGTGTTCATGAAGGCTCCATTCTGCTCACCCTTCTCGCGGACACGTCTCCCATCTCGATCGTACACGCTACAGACTCTG
CGATGTGCGTCGTCCTCGGCGCCACCACCGCGTGCCACGTCACCTTTGCTTCGACGGATGCCTGTCGCGCATGGCTGGTTTCCCTGGCCTCGTGCTTTAC
CGCCCGATTCCAGTCGGTCTTTTCTTTCGATCTGCACGCGTTGCTGGCGTCGATGCAGCAATTTCCCAAGTCGTGGCTCGTAGCCGACACCGACACGGCC
AACCACGACCTCGTCGCGTCTGCTGCGATGTGGTTGATGGATCTGTCGGCACCGTCCGCCGCCGTGCCGCCGCGTTTGCATCAGGTGTACTTGATGCGGG
ACATGGTTCTCTACGGCCGGATCACGTCGCTCTCGACGTGTGAGTTTGGCGGGTACATTCTGGGCGAGCACGTTACAGTGCACGACACGCCGTCGTCGTC
GTCCGCCGCTGCCGTCTTGCATGTGCACGCTGCTTCTCCATTTGAAGTGGAAATCACGCCAGATGACGGCGGCGACGACGGCCAACCGTCCATGTCGCAG
CGGCGGCTCCTTCTCGCTCCCGTGGACCCGTCGGTTCGACAGGAATGGGTGGAGCTGCTCCAGCAACTGAAAGCGGACGTCGTCGGTGCGTCAGACGAAA
GCCAAGACTTGTATTACTCGCCCTCCCATCCTTCATCCATGGTCACATCATCCCACACGACCATGGCTACGTCGTCGGAAGGTGGAAAGCATGAATCAAA
GTCCACAAGTGAAATCACGAGCAATGACCAAGCTAACAAGCCAACACCAGTGCCTGAAACGACTGGCTTGAAGCCAGCTGCTCGCATGCTTGAGATCGAC
GACATGGACCGATTGCCCACGTCCGACACTGAAATTGAAAGCGGTGATGATGATGGTGACAGTGCAAGCTTGGACTCGATGTTGTGCGCCAAGAACCCCC
GGAAGCGGTCGTTTGCGCAGATCCACTCGCCGTCGCCAACTCGGCAGGGGGACGAGAGGTTGAGTGGCGGAGTGGATGATACATCTATTTGTGCGGAAAC
CCCCGACGCTGTCGACCACAAGAGTCGACTCGTGAATTGTTTAGCCCAAGAGGCTTCGCCGCCGTCGAAGCGTGCGATAGCGTTTGCCTGCGACTCGGTG
GACGACACGACGTCGCAGGTTTCGATTCCGCAAGATAAGGAAGGCGGCAAGGCTATTCCGTGCCTTGCTACTCGACATCATACGGCCATTGCTTCCAGTG
TGATCACACCTGAAGTACCTGCACCGCCATTCGCTGCTGCAGAAGTAGAAGGCACCATATCCCATGTACCTGCGACACGGCGCCCGTCGAAACCACATAA
GAAGACTAGCCGACGCACAACCAAGTCACCCACCAATGCTTGTACTGCACTGGGCCTGCAACACACTGCCAAAGTCGCCACCTCGTCCAACGCAACCGAC
TTGTCCGATGGGGTTCCGTCGGAGTTGCCGCCATCGACGCAAGAGATGGAAGGCGGCGCTCTCCAATTCCTGCGCGACGTCCCATTTGCATCGAAACCGT
CGGACGACGACGACGCCACGAGCATTCGCATTGCCTTGTCAGGGTTTGATGATCCCACCAGCTTGTTCTCCAAGGTATGTACAATGAGAAGCTGTCCATA
TATATATTGTGCATGGG