Description :
From Genome Similarity Track
Location :
Scaffold_145:9875- 14370
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_145-abinit-gene-0.74YALI0D01133p
Pytiw_DAOMBR242034maker-piw_contig_145-snap-gene-0.20Dihydropteridine reductase

Sequence
4495 bases(100 bases per row)
AGAGATGGAGCGACTCGTGCTGGACACGTCCGAGGTCTCGGAGGCACTCGGGCAGCTCTACAACCCGCTGAGCTCGCCGCGCATGCGCCGGCGCGCCGAC
TCGCTCCTGCAGCGCTTCCAGCGCACGCCCAAAGCCGCGCAGACCGCGCTGCAGGTGCTGCAGACGCTCATCGTCGAGAGTCCGCAGGTCAAGGCTGAGC
GCGCGTTCGCGGCGTCCACGATCTACTTCACGGTCGCGTCCTACGTGCGCACATACAAACTGGAGAACCCGGGGCTGTGGACCGACGACGAGCGCGCGCT
CCACGAGACGCTCTCTAAGGAGTTCGAGCTCGTGTGCCAGGAGGTCTGGAACGTGCTTACGGGTCCGAACGGCGCGCTCGAGGAGGTCAATGTGCAGACC
CACCTGGCGCTCACGATCGCGGTCATCCTGCTACGCTTCCACGAGCAGAGCGAGGCGTCGGCCGAGTCGTCGGCGGCGTCGATCGTGGGTGCCGTCGAGT
GGCTCGTGACCAACCAGGCCAAGAGCCCCGCGCTGGACGACGTGGCCTCGAGCCTCACGAACTTTGCGATCCTGCTCACGCTCAAGGTGATCCCCGAGGA
GGTCGAGAACAAACGCGTCAAGTTCTCCAAGACCAAGCGCGCGCAGTGCGAGGTGCTCGTGCAGCAGTCCGCGCCCTACGTGGTTAACACAGTGCTGCCG
ACGCTCGCCAAGGCCATTGACGCGGACGAGAAGCTCGCGCGCCTGCGTGGCCTGCTGCTCAAGTGCTTCTCGAGCTGGGTCGAATACGGCAGCGTGGCCC
CCAGCGTGATCATGAACTCGGGCTTGCTCGACCGCGCGTTCCAGGAGACGATGAACCCGCAGTTCTCGGAGGACGCGCTGCTCTGCATCCGCGAGGTCGT
GCGCGCGTGCAACAACGACGGCTGCATCCCGCTCATGGAGCTCGTGATGAAGGACTTTGTGATCCTCGGCAAGCATATCATGGAGCGTCTCGCCGCAAAC
GACGCGGTCGGGTACTGCCTCAAGGGCTGCGCGACCGCCATGGCCGAGTGCGGTCAGTCGTTCATCATGTATTTTGTGGACTACACGCTCGACCTGCAGC
CGGGCTCGCTTGTGTACGAGTTCCTCGACACGATCCTGTCGTTCACGGCCATGAACGACATCGAGATCTCGAACGAGACCATGGACTTCTGGATCGACTT
CCGCGCGTACATATCGGGCAAGCATGAGCGCCGCATGATGGACTTCGAGGCGTTCATCTCGCGACTGCTGAGCATCCTGGTCCAGCGCACCGAGTTCCCG
GACGGGTACGAGTCTTTCCCCGTTGCGGCACGTGACCGCTTCACGAGCTACCGGAACGACGTGCGTGCAGTGTTCCGCTCGTTGGCCACAGTCACGCAGC
AGAGCGAGGACAAGTTTGTCGTCGATGCGGTCCACGTCGTGTTTCGCCAGTACGAGCTCTACGACGCCGGCCAAGCGCTGCCTGCAGTGAGTTGCTTCGG
AGCTCTGCTATTCATTCATTTATGTTTGTGCGTGATGGTCGGAATACTGATACTAACATTGCGCTGTGGTGTCTATTCCTTGGCGATAGTGGTGGAAGAA
GACCGAGGTGTACGTGCACGCGCTCAGTGCGCTCTCCAAGTCGATCCGTGAGGAAGACACGTCGCTCATCCCGCAGCTCTTTGAACTGCTATCGCGCAAG
GAACCGTGCCACCCAGCGCTCTCGCGCACCGTTACGATCTTCCTGGGGGTCATGGGCCACTGGTTTGCGCGCAACCCGAGCTTCCTGAGCGTGTACGCGT
TCCGGATCATGTCGCAGAGCTTTGAGATGAGCGAGAACCACCCGAGCTACCTGTTCAAGATGCGCATGCACGGCGAGGACCACATTGGCACTGTGGCCAT
GAAGAAGCTCACACATCGTTGTGGGAGCCACTTCTTCAGCCAGGAGTGGCTCGACGCGATGCTGAGCTTATATCGAACGAGTCGCGCGCCCCTGCCCGCT
GGCAAGAAGGCCAATCTGTCGGGCAACAGCGTGCAGATGATCGTCGAGTCGGTCGCGTACGTCGTCGCCACGGTTTGTTACAAGGACGCGGTGCCCGTGG
TCGACGAGCTCTGTGCGATCATGTTCCTCGACCTGGCGACGCGCTTCCCCGTGCTTACGGCCGACGACGACGCGCCGGCCGAGTTCCTCTGCGAGATGTT
TGACCACCTACACGTGCTCGCAGTGAAGATCCCGCCGCAGATCAACCAGGAAGTGCCGCACCCGGTGCTCTGTGCGCTGCGCAACCACTGGAAGGTCATT
GAGGGCATTCTGTTGGTGTATGGCGCGAACGAGGACGTTATGGGCAAGTTCTGCGGCCTGCTCGTCGCGCTCTTTGACTCGATCCGCACGCAGGCGCTTG
AACTCGCGTCGGCGATCATGCCGCACCTGCTGGAACAGTTCGCCCGTAGCTTTGACGGGAGCTTCCTGAAGGTCATTAAGAGCATCATCGCGTGCGCGGG
TAACGACGACGAGTCGGTCGCGAGCCTCACGCGCGTCATGCTCATCGTCAACGAGAGCGCGCTCACGCACATCGCCGCGAGTGGAAACGTCGACGAGAGC
GCATCGCTGATCGTGGACCTGCTGGACCTGGCGCGCAGCTGCGGCACGCACCGCCCACTGATCCTCGTGCGCTGCAACCAGCTCGAGTCGCTGCTGGCGC
TTGTGCTCCATGCGCTCAGGTCACAGAACCCCGACGTCGGGCTCGCGACGCTCGAGTTCCTCTCGGACATTGGCTCTTGGTACGGCGAAGTGCTGAGGAT
ACCAGCCGAGCTGCTGCGCTCGGGCGAGTATGAAGGCCAAGTGCAGCTGCACCAGTTGATCCGCACACTGTTCTTTGAGAAAGACGTGCAGTACCACCTG
CTGGTCGCGCTTTTCAACGCTGCCGGTGGCTCGATGCCGCCAGCGCTCATTGAGCGCGTGGCCGAGGTCGTACGCTCCTGCTGGGCATGCTTTGGGCGCC
AGCGCAGCGAAGAGCTCATCCAGCGACTGCTGGTGGATGACGGCTTTGTGGGCTCGCACGTCGCTGTGAGAGCGCGCAATGAGTTTGCCGGAACGATCTC
CAAGCCTGAGTGTATCGAGAACTCACGCAAGTTCAAGCGCGTGCTCACGGCGTTCTGCGACCATTTCCGCAAGTCGCTGGTGGGCTCGGTGGCTGCCACG
GGTGTCATGTCCTCGTGAATAAGAGAGATAGTGTGAGAGAGAGAGAGAGAGAGAGAGGTAATCAACAAGTAAACTAACCGCGTAAAGATATACAAATTGC
TTAAACCCTGAACTGATTTCAGCCATTGAAGGTTGGTCTCTCTGATATAAACAACTTGTCCTACTGGGGCGAACACAACTTGCGAAGAGGCACCCTAGAG
GAACGGATTGCCCATGTCTTCCCACGCGTTCTTGTTGTTTTGAGTGAGTACCGTGACCAAGTGGCCCGAGGCTGGACGCGACGCCGCGGGCGAATTCGAC
CACTCGAGGATCTTAGCAGCAATGTCTTCCACCTGTGCATAATTGCATTAGGAAGTGTGAGTGGCAAGAATTCACTGACAGACTGGGCTCATAAAGCAGT
CATTTAGTGTATTTCGTACCGTGGTCCAGGAAGAAAAGTCGGCATCCGCCATGTACTTGCGGTTCATGGGCGTGTCGATCGTTGCGGGCAAGACGCCGAC
CACAGATGCACCTTCCGGGAGCGAGTCACTGAAGTAAAAAATGGACAATGGCAAGACGTAATCAACGACCTGAGCTCTCCTCCCTATGCATTGTGATCAT
CACTACCGGCATTCACAGGACGTACACTGTGCTGGCGATCAGATGGTGCGTTCCAGCCTTGCTGATGCCGTACGAGACCATGCCAGGCGTCGCTTTGATC
GCAGCAGCGGCGCCCGTGAGCACCAAGAGCCCGCCGGGGGTCAGCAGGTTGCTCGCGAGATGAGCAGCTACACAATATCATCGCATTGTTTCAATGAGCT
ACCCAATGCCACTATATACGCACACGCTGTCAACATCATCACACATAGCTAACAAATACATTCACGTACAGAGAACTGCAGACTCGGTGTTCATCGCGTG
CATCTGCGCGAGGTTGGCGAGCGAGTCGGCGTCCTTAATGCTCCCGCCGGCCCAGCCGCCAGCGGCGCACACCACCGCGTCCACACGCCCGTAGCTGCTC
AGTCACGTCCCAGCAACCAGAAAGGTGTCAGTCCGCAGTAGCAACAAGTCCGCATATATACCAATACGTAAGCGTGGACCACGTACGTGCTCTTGATGTG
CTGCAGCACGCTGCCCGCCTGCGCGAGCGTGCTGCCACCGCTCTTGTCGAACACGAAGGATGCGTCGGCGTCAGCGCTGGCGCTGAAGTCCACGGAGAGC
GCCTGCCAGGCCTTGGAGCGCGAGAAGTGCGCGCTGATGCCGCGGCCGAGGGCGCCGGCGCCGCCGATCACCACGAGCTTCTTGGTGGCCATTGC