Description :
From Genome Similarity Track
Location :
Scaffold_37:98744- 102707
Transcript NameFunction/comments
Phyke_g2214dynein heavy chain
Phyke_g2215hypothetical protein PHYSODRAFT_293856

Sequence
3963 bases(100 bases per row)
GCCGACTTTGTGTGTACGGGGAACGGATACAATTTGGCGCTGTCAGATGGAGGATACAGCGTGACAGTCTTCTTTCCGTATAGCACCACCAATATGTTTT
GGTACGCGTCGTAATGCAGAGTAGTTCGACTTGGCTGCACAGTCATCCACAAATTAACTTGCGTCAAAGGTTTGTCTTGGAGGCACTTTGGTCTAAACAA
CGGCAAACAGTCACGGGTCAGACTCGCTACAGTACGAGCAACATTGCAACGACAAATGCACTTACAAGCAGAACTCATTCATGATAGATGGCAAAGTCGC
CTTGGTGCAAGTAGTATCAGGCTTGTACACTGCAATGGGGCATTGGCACAGATAAAACTCCAAGTCGTCCACAGTTTGCAACCAATGCGATTGGTTCGTG
AACGAGGCTTGGAAGTAATCTACAAAATCACCGAACTTCAATTCCACACTCTGTCGCTCCTTGTCGGTGCCGCAGTAGCAACCACTCGAGCGCTCTTTGC
ATGCTATATCAACCACTGCAACACCAGAGCCGTCAATTCTGCAGTCATTCACAATAAACCCACCACATAACGTTCTCACCAGTGCTTCGATGCGACACAA
AGGGCTCCAGGAGGTGCACTGAGTGTGGGGTAAACTTAGACAAGCTGTCCGCGCGTACACACTCAGTAGCAAAGCCTACGTAGAGGACCGGATCGTTCAT
GCCGCCCAACTCCATCGTTTTCTAGTAAGACAAAAAAGTGTCGGTATACCGGTGTCAATATGACTttgcacacgtcacagacgCAGGTGTGGTGACACAA
ACGTTTGTGGTTGACTTCAATGAAAGTAAAAGACTTTATCAGTGGAAAGAGTGCTGGAATCTTGTATGATAGAGCCCTTGTATTCATTTCTTCTCATAGC
TACGTGCTATGGTGTGTCCTACTATATGATAGTTACTAGATTGCTAGCTCGTCATTTGGCTGGCGTGCTGCTCCACCAATTTGGCAACCGGAGCAACAAC
AGGTTCCAGTACTGGATCGTTTGACGCGACCTTACCAACTGTAGCGGCTTTCGAGTGGCGAACACAATAACCATGGCGCTGAGCCCACTTTTGACAGCCT
TGCTCAGCACAGCGCGAGCCGCCGCCGTGAGCGCGGCAAAAGCCCTTAGAAATGGCCCCCTTCGTGCAGCCAGGATGCTGACACCGCACGCCCCCACCGT
GCGTCTTGCAACAGCCACGGGATTGCACAGCCCGTTTGCAACCCTCCACACTGCAGTATTTGACACCACCGTGCGCGCTGCACTTGTGGCCAAACTGCGC
CACGCGTTCGCAGCCATTCTCCGCACACAGTCGTCGCCCACCATGCCCAGAGCAAGCATTATTAAAGCGTGCAAACTTGTTGCAACCTTCCACTTCACAT
CGCCGCCGCCGGTATCGCTTGGCGACTGTCGTTGATTCTTCAGTCGCGCCCCTTCCCGTATCAACAGCGGCGACCGTTAAGCCTTcagacgatggcgatg
gtgcagtTTCTTTGGCCCGATCCACTGTCTTCTCGATGTCTTGATCATCTTTGCTTGTATTGCTTTTTGGTGCAGACACTGCAGTCGTCtctggagcaac
agcagcagcagctgtcTGCTCGGTTTGTGACTGTGGTTGAGTCTTCTGCTCCCCTTTTGCAATCACAGCGGCCTTGAGTAGCGTGTCGATCCACTCGCGC
ACAGGATGCGCCTGTTCATCCGTTGTAGAACTTGAGTCGTCCGTCTTGGGAGGCTGGCTGGCCACCTCGCTCATCGTCGTCCGCGCACTTGCTCCAGCGA
TCTCTCTTGTGTCACCCGTCACAGGGACTGGCGGTTTCGTCTTCGTTAAAGTATTGGTCTTGATTTACCTTGATTTCACTATCAGCTCAGGAATGGATGG
AGCGCACCACGTCGCAGATCAgcatttcaaccaatcctCTTACTTAAAGTGCTGTAAAAGTTTACGATTGGCTGAAAGCACCTCACTCGTTGAAGTGACC
CAAATGCCGGCTTCAACGTTTGTTGGACCCTTCCGCCGTGAcaacaccaccaacgccGACGAAGGTATACAGCCATGGGAGTGCTCAATCTGCTCGACGA
CCAATGAAATCAGTGATGAAGTCTCTCCAGCGCGTTGCCAGGTATGCCAACGCCTTCGTAATCCGCAATGGCTGTACCTGGGGGAATGGGAATGTCAGGT
ACGATTCAAACCAAGTTTCTCAAGTCGGCAAGTTATCCACACTAAGACACTGTCGTTAAAAGATCTGCTTAGGCTCCCGGGTCTGGCATACTAGTCCAGG
AGGCTCCAAGTTTGTCTCCATCGTTGTTGCCATTAACTTCGTCCAGAAACTCGTAACCTTACTGCGGGTGAAAGTCAAAGGTGCAGAATTCAAAAGTGGG
GGCCAAAATGCTGCAACAAGTTTCCACGTGATTGTGCTTAACGCGCTACAAGTCCAAGAGCAACTTATACCTTTGGatgctgaggaagaagctgacaGTT
TACTTGATAAGTATGGCATCTGTGGAGCTTGTCGCGGCGTTTATCGCATCGAACAGGGCGACATTCAATCGCAATATGCGAACGAAGATAAGATTGCTGT
CCTTCTGAACGAAATTGGACGACTAAGCGAGCAAAAGCTACGATTTGTGCGAGAAAAGGCATACGAGCGGGTGGTGGAATGTTCAGAAGAGATCAAGTGC
ACGATgaaacagcttcaagtcGCGAAGCGTGAGCTCGAATTCCTCAACCCCATGTTCTGTCCATTTTGCGGGTGGTTCCCACCAAATGAATGAATGAAAA
GACCAACGCATAGGATTGGTACAACAAAATTATGTTTACCTAGTTTTAAATACTCAACGAGAATGTTCGTTCCTTCTGTCGGTGTCGAAAGTAGAGTAAC
AGCGTCATCCGGTATTTCCAGTTGGGTCAACTCCGTTGGTCGTAGCACTGGCGAAAGATCGTGGTGCTTCTCAGATAACAGCTCTAAGCTTTTAAAATTC
GGGGCAATGAGAATTACATGACTGAACAGCCAAACCAGGACTCTTCCGATTCAGCCGCAGCCGATCCCTCCACCTGATTGTCCAAATTCTTCATAGCAGA
CGCGATATGCGTAGCAAAGTATGGATGCCATACGTGGTCATACAGGAACCGCGCGGTAAATGGGAGATCGTCCTTATACGCTTTGGTGACCTTGGTACCA
CCCCACACACGGCTCCGCTCCACGATCCATGGTATCATGATACGCTTGGGTCTGGTCGCACGAAAGACACGTGGCATTACATAGCGCTGGAAAGCGCTTT
CCGAAAATGCGAGTTCAATTGCTGGCTTGAAagcctcttcttcgagcgcCAGCACATTGAATAGCAGGTGATTGAGTCGGCGGATGTCATCCTGCAGAAT
TGTTAAGCGGTTCTGCCAAGACTCGGCGGACGTAGCAGAAAACACCAGTCCGTCTTCTTGGGCGACAATCACGTCCATCAAAGCATATACACCTTCGTAG
AAAGCCACGACATCGCGTTTGTCGACAAATTTGATGGCGACAAGCGGGAGGAGTACCTTCGTCTTCACGTCGTGCTGGTTCTTTACAAACTCGATGAAAT
ACTGCTTGAACCAGCTGAAGAATTCCCTCACGTTCCAGCTCATCGGTGACTCCAAATCACGGCTACGCTCGAGGAAGCGATCAATGACGTATAGTGCATG
ACGAACGGGTTCGTGTAACCCCAGGAGAAACTGTGAGTTCCAGCTCatgtcaacttcatcgttGCGCGTTAACACTGTTGAGAACACGACATTTTCACCT
TTGTACTGTGGTCTCGACACTGGAGCACTCGTCACGTTAGTGAAATCGTCAACTGATAGTTCTCTCCGGAGTACATTGGTATCCATTCTCAATGGACCGA
GGCTCAGAACGCTGGATGTTACTGATGACGATCCATATTCACTTTCGTGCTCCGAAATAGCTA