Description :
From Genome Similarity Track
Location :
Scaffold_80:98692- 100131
Transcript NameFunction/comments
Physo_139943hypothetical protein

Sequence
1439 bases(100 bases per row)
CCCGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGA
CTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGTTGTTTCAGCTTCTCGGC
ACACGACTGTCGATGTCAACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGG
AGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAGTGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGGACGC
GTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCG
GACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACATCATGGCGCAAGCCCAAG
ATAAACAGAAGGGTTTCTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACGTACCGCTAAA
CACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCC
AAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGG
TGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTGGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCA
TACGCAGGGGCGTCGTACGAGCCCTGGCCAAACTGGGCTTGATACGAGTGGAGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAA
GGCCAGCGAGCTGGTTACGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAAC
ATCCTCACGGAGCCGCTCCACGGCACCAGACTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGG
TCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGTATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCG
AGGCCACCGCCGGCCCTCCTTGATCGCAATTGGCAGATC