Description :
From Genome Similarity Track
Location :
Scaffold_454:9868- 16454
Transcript NameFunction/comments
Phypl_g8487hypothetical protein PHYSODRAFT_502426

Sequence
6586 bases(100 bases per row)
ACCAGTTGAGTCAGGAACAGGAGCTTGTGGTCTTCGAAGAGGCCTCTTGTTACCATCGAGAAGATCGTCCACCGCAGTGCCTCCTTCAATATACCCACCC
GATCATgagcagtagcagcaccgTGAGTTCCATCAGCATTGTTGGCCGTGGTAGTCGCGGTAGACGACGGGGCAACTCCATCCAaagccacgaagaagaa
ggtcatGTACGACTCGAGTGAGTAGCGGTACATGTGATTCACCTTGCATAGCTGACTCATCAGGAAATACATCATGCTCGCCTCGTTCGCAACTGGCCGA
TAGACCTCTCGAGCAAGATTAATCTCGCGCTCCGCGTCTTTTCCTTTCCGCAATGCGATGCCAACGTCAATTGCTGTGAGCTTGGTCTTTTCCAGGCCTT
CAATCAGCGGAACATCAGATAAAATGTCGTCCGGAGCATTCGACAGACGTTCCAGAAGATCGTTTTCGAGCTGTAGCAGCTGGATCTGATACCCGTTAAA
CTCTTGCTGAAGTTGACGTTTTTGGGTTTCCAACTCGGACTGCTCCAAGTTCACCACGTTTGCCAGTAATTGGTCCTCGAGTCCCTTCTCCGTTACGCTG
AAGTCGATGAGTGTGCAGTACGCCAAGATTTCCGGCCGGTAGTGCGGgttcggcagcttcgtgtgCAAAAACAAGCGGAAACGAGGGTCCACTTCGATCT
CTTCAGCCGCGAACTGCAGGAACCAGTTGCGTCCCTTCTTGTAGATCTGCCGCATGATGACAGGCTCCAAGGAGGCGTCAATTCCCTCGCCTAGGTTCTC
CAAGATGACACTTTGTCCATTCGTAATCGCAGTCTTCAATGTAGTCGTCCAGTTCTTTTGAGCAGGTTGTAGAATTACCAGAGATTGACCAGTTGCCTCC
TGCACTTCTCGGCCTGCAGTACCTTCGGGTTTCTTATGCCGAAAGTCACGAGCGCGTAGCCAAATGATTCCTTGTAGCTGCGGGTCCACTAGAAGGGGCC
ATCGCTGACACGACGTAATGATGCATCCGTTCTCTATTGAGATACGATCGGCTGGCAAACCTTCATTCATCCACTGGGCCACATCGCTGCTGTCACTGAG
TACATCAAGCGGATCGACGCCCATATTCTCactcgatggcgacgatgcaGACGCCGAGGAAGGTTCTAACGATACTTCAGCATCAGTGACCCCTCCGTTT
TCAGTAGTCTCAACCCCGTTCGAGCCGGCGCCACTCATATCTGCTGGCGTTCCAAGAGTAATTGGGATTTCTCGGGTAACAATATCTGGCAGCCACGTGT
TCTTCCAAAGCTGAGCTCGGAAACTTGCGTTGAACGCGCCGATGTAGCTGACGAACCCTGCTGCAAGGAGCGAGTCGCCGATGAGTGCGCTCTCACCAGC
CCGCAGGACATCAATTTCGTGACTCCATCGCTCATTTTCTGATGCCAGGCCGTTCACTAACCGCTCCGCTAGTGACAGTCGCTCTTGGCatgcttgcgct
tcagccTCCACCTTAGCCTTCTCATTCGTGGCATCCCGGAATGAAGCTTGCAAAGCATTCAGCTGACCTTCGACTTCTGCCACCAATTTTTGCACCGCAG
CCAGTTCACTGTCCGCATCTGCCTTTGTTTGGCGAGCTTTTTCTAGTGTATCCATCAGCGGTTTGACGCGCACGAAGACTTGGTGGAACGAGATGATGTT
GACGACCCACACGCACAggttcgcagcagcaacggacTTGCTCTTCATCTTTTCGTAGTTGAAATTCGGGTCTTCTTGGATCAGCGGCTCCACACGAGCG
ACGACCTCCAGGGGGATATTTTCCTTGTCATATTGCTCCAGTGATTGCTTGAAGACATCCACCTtcgccatcatcttcttggcgttaTCCCAGCTGAAgt
tcttcgtctccttcttAACCATCATGAGAACTGCTGCGGTTACCTTCTCCACACCAGCTGGGGGTTTTCCCATTGACTTCAGCTCTGTCAGCGATGCCTT
GTTCAGGCAATTCACCGCTTGCTGGGCCGCATCCAGAGCAGGCTTGGCAATGGCCAGCTCGACGGAAGATTGTGCTTCAATTTGAGAAGCAATCTCTGCT
GCCTGAGCTGCTTTGGCACGCTCCTCGTCGGCACGGCGCTGTTTTACCTCAGCATCGCCACGTTGCTTACccatctgctccagcagcagatcggTGGCTT
TCTTTCGCTCTTCCACCTTCTTCATTGTCAGCCTGAGCTCGTCTTGAAGCCCTGCAACGTcgagcgccgtcttcttgagtGTTGCTAAACCCACATCAAG
ACGCTTGATCTTTAGCGTCTGCGACGATCGCTTCGCTTCTAGAAGTGATCGGTAAAAACGGATGAGCTCCAAGAATGATGTTGGCGTCACGTAGTTGTGT
CGCCCGTAGCTCTTCGCGTACATCGTGCACGCTGTTGTCACCGACATGTGCATCTCGGCCATGTGATGGCAAACATTTTCCTGAATCCCACGCGTGGACA
GCTCCACATCCTGCAGGAAGTTGAGCGACACGTCTACCAGTGCCTCTTTTGGCCACGAGTGGAACCAGTtcatgatgcagcagctgataAGCGACGGAAA
GTTCCTGCATCGAATGCGCAGATCACCCCCTACCGGAGAAAAGGCCAAAATCAGGTGCATATTGCTTCGTACACGCTCGTAAAAGAactcctggagctgc
tccttcgtaTCTGGGATGCCACGCGCTTTCGCTTCCATACGTAAAGACCCAGTCATCGACTCCATCTCCTCACTGGAAAACAGGTCCGCGATGCAACCCG
ACGTTAATGCATCCATCAGCGGCACCAAGAAACGATTGTCAGTGATCTGGGCGTCCGTGAGTAGAAGTACGATGGGCTTTGCGGGTCGGACACCCGCTTT
GCGGTAAATGTCCTTTAGATCTTCTTTGAGCTCACTCATGTCATAGGACGGGGAAGCACTTGTAGTCAGCGATACCAAACTATATCCACATATAAACGCT
GCTAAGCGTGAAAGTGACTGCTTTCCTGAACCACCAACGCCAATCAGCAACGCATTTCCCCGCGGGTTTGCCAGAATGCGAACTATTCGAGTCACATGCT
CCAATGCTTGGTCAAACAATACGAGGCTCATCACTGGATGCGTCTCGTTGTACTCAGCCAACTTTCGCTCCAAGCAAGCTGTGAGCTGGGCCTTCTCGAC
TATAGGGACATAACTGAGACTCGTGCCTCCGTACTCGGCTTCCATCGACATTGATCCAGACGATGAAGCACCCAAGAAGTTTACACAAATGAGTGGTGCC
GCAAAGATCTCCCCCTGGTCCTCTTCAaagttcttcttcgtttGCTCGACTGCCATCTCGGCAAATCGTTGGATCTCACTAGGAGAGCTCATGCGATCGC
TAAAGACTCGGAAGCACTCGTGAATCCAAAGACGGCAGAACTGGAGCGAATTATTTAGATAAGCTTCAGGCCGTGCCATGAAGATACCTTGGAACAAAGA
GCTCAGCTCCCGCATACTGAACACGTAGTGGAACTTGGTTGCGGTTGGAAGGAAGTTCGCGCGTACCTCCGCGTACAAATCAATCGTTGCAGTGATGATG
GAAGGCGCGAGTTTCTTGATTTTATCAGCGAAGTTCGTGAGGTGCTGATTCAGGAGAGCCGAGTAGATCGTTGTTAGGTCTTGCTTCGACGGCATGCTGA
TGCACAGCGTTGAGAAATGACGATGCAGGCGAGGGTTAACCGTGAACGATCCAGCCTTGTGGTTCATGCAAGCAAGGAACTGGACGTCTTGGATCTGCTT
CTTTGACGACAGGTCATGACGATCGTACCACGAATTGTAGTCCATGTATTGGCGCAACAGTGCAAGAGCTGTCTGGGTACCGAACTCTTCGACAAACGGT
ATATTCAGATCGTCCAGAAAGTAAATAAGCTTGCGGTTGTAAAGCGGCCCGTACACACGACCCGACCTTTTCTCCAGGTACTGTTCCAGAcgagcttgca
gctcgcgggCGTCCATGTAGTGGTGCATGCTCACATGCTCGAAAGTGATGTCATCTTCCAGTCCTTTCATGTGTTCGTGAACCAGCGACGACTTGCCTGA
TCCACTGGAGCCTACCAGAATGGTTGGATTCctcttgtgcagcagcaattcAATGATCGAGTGCACACGAGTGGACTCCAGGGTGGGGACTACGAGCGCA
TGGAATGGGATGTCTCCCGCGGGAAGAAGCGCTGGTACTTTGTCGCCCCAGTAGACCATCTCGTTGTGCGTGATATCATAGTAAAAGTCAAAGAGATTCG
CGTTGCCACTCACCAACATCGCCGCACTATTAACATCAGCCCCCCCTGTAGCTCCTGGGTATGAAGCTGACCCACTAGTAGTTGAAGCAGACGCAAACTT
GTATTTCGCAACGGCTTTGAAATGCGTAGAGAACGCCGCTCGGTCATCAGTCCCCTTGTCACTGGCCAACGCTCCTCCAAATGCCCACATTCCACAGTAA
ATAAACGCATTCTCCAGTACTTCAGGCGTCTTCTCGTGCTCACCTACCAAGCTCAGCAACCCGTCTAACAGACGGCAAAGCATTTCCACCAGTGCGATGG
AGACAACCGGCACGATCGCCTCTGCTTTTGTCTCATCAAGGGCCAAGAACATGCCATccacgtacttcttgaaGAGACCAGGCAGGATACCTGCCTCAGC
ACTGCTTTCACGTTGTTGCAGCCAGGACTCAACTACAGGGTACCATCCGATGTGCCCCTCGTCTACGTAGATGATGCCTGCTCGCGATACAGTAGCCGGC
GTTGCATTCACGAGCGACGATATTTCAAACACCAGTCTCATCGAGTTCGTCAGCGGGATACGCTCGTTCGAAACCAGAGTGAGAACTTTGTTGTCGTCCA
TCACCGTGTTCATACTTTCAATCCACACTGCATCAATGTCGCCGTCCAAAACGACCCACTTGTAAGTCTGTGATTCACTGTATGGTGCCACATTCTTGGA
CATGTTGCGCATGATAGACGACAGAACGCCGTCTTTCCAGTCGTTATCGAGTGTCATGTAGCCGTATAGCTCGTCAGCCGTGATGGCCTTTGGGTTCACA
CTCTCGTATATGGTCAAGTGCTTCGCCAAGGCACGTCCGTCGTCATCTGCGTTGTGGCACGCAGCGAGTGTGCTCCAGATTGTGCTTTTACCGCATCCGG
CTGGCCCAATCAACATCACACTGTGCCGTACTTTAAGGACCTCTTCATACTccaccatcttcttcagGAAACCCTCTTCGGGCTGTagcttcttctgcgc
gcAGACACGAGAACATTTGGTCTGTAGCGAGTCGTTCTTCAAGTGTGGAAGTCCTTGGTTCGGGAACAAGTCTCGAAGCAAGCCCATAAAGACAGGGTAG
TCCGGAGGGAGAATCCGTGGTGTGTTAAAGTCGCGAAGGACTTGCATCAACACAGTCTCTTCAGAAAGAGTGGAGTGTGCTCGACGCAGACTACCGGCGA
CAAGAAGCACCGACTTCACAGAACGAAGTCCCCAGTCGTAATGCTTCTGCTTTGATAGCAACTCGCTACTTAGGTCATACAGCGTCACAAACTTCGAGGA
AAGCGTGCGTGCCTTCAGGAAACCCTCTGCCATCAGCATATTCTCACAAATAGGCTGTAAGTCAGGCTTGATCATCGCGCACGAACGGAACAAAGCCTTC
AGGTTCTCTGGCAACTCGGCGCGACCAGCATACCCCGGATTCATCGTGATAAAGAACCCCACAGTCGGTACTAACGCGATCGTTTTGCCGAAGAACTCGC
AATTACCGGTCCGTGGCATTACTATGGGCTGCTGAGCACTTCCTTCCCCTCCGGATGAACCAACCTCACCGTTACCAGTTGATGGCCCACGGTTTGTTGA
TGCAACAAGTAGGGCATTAGCATCTAGCACGGTTTTCACCTGTGTTGCTACCACGGACAGCACTTCGACCGAGATACGATTGAATTCGTCGAAGCAACCC
CATGCTCCAGTTTGAGCCAGTCCGCGGAAAATGTTCGCCATCGTCAGGTAGTTCATCTGATCACTACAGTTGAAGACGTAGCATTGGAGTCCCATTCCAC
GGGCGAGGTCCTTTGTCGTCTCCGTTTTTCCTGTACCTGCAGGTcccgctggagctccaccTAGACACAGTCGCAGCGCTGTAGTAAGGGTCACGTAGCA
GCGGTCGGTCAGAGGTGTTATTACCAAGCGCCCGCAGTTTCCAATGTACTCGTAGCTGTAAAACGAGCGGAAGTCACAAATCTTGATGTGTACTTCCTTC
TTCTGTCCTGCACTCGTCAATACTGGCGTCGTATAGTAGCGCAGCTGAGATTGCCACTGAAAGTCAAGCGAGCTCGAAACTTTCTTCGTGATCAAAGACT
GCACTACGTCACGTGCATGAACGTCAACAGTGATGAGCGTGATGATCTTTTGGCGGTTCAGCGCTCCAAGTTGACCCTGAACAAGCTTAATcagctcttc
cagccgcACAGTTGACACGTCGTAGTACTTCTTGATGGCATCTTCCGTACCATTCTCAAACTCTTCTAGCGCACTTTCGACTTCCT