Description :
From Genome Similarity Track
Location :
Scaffold_2:986623- 990940
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000829Similar to Tnpo3: Transportin-3 (Mus musculus)
Pytul_DAOMBR144PYU1_G000828Similar to qdpr: Dihydropteridine reductase (Dictyostelium discoideum)

Sequence
4317 bases(100 bases per row)
GTGCGATTCTGAAAGCGCAAAGAGAGAGAGACCAAGATGGAGGTGAGCGTGGTGTCGGAGGCGCTGAGCCAGCTGTACAACCCGCTGAGCTCGCCGCGCA
TGCGCCGCCGAGCCGACTCGCTGCTGCAGAATTTCCAGCGCACGCCCGAAGCCGCACAGACGACGCTCCGCGTGCTGCAGGCGCCGATTGTCGACAAGGA
GTCACCGCAGTTGAAGGCCGAACGCGCGTTCGCGGCGTCCACAATCTACTTTACGGTCGCATCGTACGTGCGCAAGTACAAGTTGGAGAACCCAGCGCTG
TGGACCGAAGACGAGCGGCAGCAGCATGAAGCGCTCTCGAAGGAGTTTGGTGTGCTCTGCCAGGAGGTGTGGAACATCATGACGGGGCCCAATGGGATTG
CCGAGGAGTTTAATGTGCAGACCCACTTGGCACTCACGATCGCTGTGATCCTGCTGCGGTTTCACGAACAGCACTCCGAGTCGACGATCGTTGCCGCCGT
TGAGTGGCTCGTGCAAAACCAGGTGAACCCGATCCAAGACGACGTGACGTCGAATTTGACCAACTTTGCGATCCTGCTCACGCTCAAGGTGATCCCGGAA
GAAGTCGAGAACAAGCGCGTCAAATTCTCCAAGACCAAACGCGCGCAGTGCGAGGTGATGGTGCACCAGTCGGCGCCGTACGTCGTGAAGACCGTTCTCC
CGACGCTCGCGAGGGCGATTGATGCCGACGACAAGCAAGTGCGGCTGCGTGGATTGCTGCTGAAGTGCTTTTCCAGTTGGGTCGAGTACGGAAACGTGCC
CCCGACACTGATCATGGAGTCGGGCTTACTCGATCGCGCCTTCCAGGAGACCATGTACCCGGCGTTTTCTGAAGACGCGCTGCTCGTGATCCGAGAAGTC
GTACGCGCGTGCAACAACAACGCGTGCATTCCGCTCATGGAGCTCGTGATGAAGAACTTTGTACTGCTGGGAAAACACATTGTCGAGCGACTCGCGACCA
ATGATGCTGTCGGGTATTGCCTGAAAGGCTGTGCTGTCGCAATGGCGGAATGCGGCCAATCGTTCATCATGTACTTTGTCGACTGCACTTTGGATTTGCA
GCCAGGTTCATTAGTCTACGAGTTCCTGGACACAATCTTATACTTTACGGCGATGAATGACCTCGACATCTCGAACGAGACGATGAACTTTTGGATCGAT
TTCCGCGCGTACATCTCGGGCAAGCACGAGCGTCGCATAGCGGACTTTGAAGCGTTCATCTCGCGGTTATTAAGCATTTTGATCGAGCGAACCGAGTTCC
CAGACGACTACGAGAGCTTTCCTGCGGCAGCACGAGAGCGATTTATGAGCTACCGGAACGACGTGCGCGCAGTGTTCCGATCGCTTGCGACCGTGACCCA
GGCGAGTGAAGACAAGTTCATCGTGGACGCGATCCACGTCATTTTCCGGCAGTATGAGCTCTACGACGCTGGCCACGCGACGCCGACGTGGTGGAAAAGA
ACGGAGGTTTATGTGCACGCGCTGAGCGCGCTGTCCAAGTCGATCCGCGAAGAAGACACGTCGCTGATCCCGCACCTGTTTGAGCTGTTGGCGCGGAAGG
AGCCGTCGCATCGCGCGCTGTTGCGCACGGTCACGATCTTTCTGGGCGTCATGGGCCACTGGTTTGCACGGAATCCGAGCTTTCTGAGCGTGTTCGCGTT
CGAGATCATATCCCAGAGCTTTGAGATCCCCGAGAGCCATCCGACGTTCCCGTTCCGCTTGCGCGAAGAAGATCATCTGGGCACAGTCGCGCTGAAAAAG
CTGACGCATCGGTGCGGTGCCCATTTTTTCAACCAGCGGTGGCTCGACGCGATGCTGAATCTGTACCGCACGAACCGCGCCACCAAGGGCACGAAAACCG
CGTGTCTCGACGGCAACAGCCTGCAATTGATCGTGGAATCCGTCGCGTACGTGGTGGCGACTGTGCCGTACAAGGACGCCGTGCCTGTAATCGAGGAGCT
TTGCGCGATCATGTTCCACGACCTCGCGGCGCGGTTTCCGACGCTGAATGCTGACGACGACGAGTGCGTCGAGTTCCTGTGCGTGCTGTTTGCGCATCTG
CATGTGTTGGCCGTGAAGATCCCGCCGCAGATTAATCAAGAGGTGCCGCATCCGTTGCTGCGTGCTCTGCAAACGCATTGGACCGTCATCGAGGGCATTC
TGCGCATCTTCGGAACGACTGAGGATGTCATAGGCACGTTTTGCGGGATGCTTGTCGCGTTGTTTGATTCGATCCGATCGCAGGCGCTCGACCTCGCGGC
GGCGATCATGCCGCACTTGCTCGAACAGTTTACACGCAGCTTTGACGGCAGCTTTTTGAACGTGATCAAGAGCATCATCGCGTGTGCGGGCGATGACGAC
GGGTCGATGGCGAGCCTCACGCACGTGCTCGTGATCGTCGTAGAGAGCGCACTAAGCCACCTCGCGACCGTGGACAACGCCGACGAGAGCGCGGCGCTGA
TCGTGTCGCTTCTGGACTTGGCTCGCAGATGCGGCTCACAACGCCCCGTAATCCTCGTGCGCTCGAACCAACTGGAGGCGCTGCTGGTGCTCGTGTTGCA
TTCTCTCAAGTCACAGAACCCTGAAGTGGGGCAAGCGACCTTGGATTTCTTACTGGAAGTTGGCTCGTGGTATGGCGAAGTGTTGCGCACACCTCCGGAG
CTGCTGCGGTCGAGTGAGTGGGAGGGCAAACTGGAGCTGCACCAGCTCATCCGCACGCTGTTCTTTGAAAAAGACGTGCAGTACCACTTGCTCGTGGCGC
TGTTCAACGCTGCGGGGGGTTCCATGCCACCGAACCTCATCGAGCGCGTGGCTGAGGTCGTGCGCTCGTGCTGGGTGTGCTTTGGCCGCCAACGCAGCGA
AGTGCTGATCCATAGATTGCTCGCGGACGATGGCTTTGTGGGCGCCCACGTCGCTGTACGAGCACGAAACGAGTTCGCCGGCACGATCTCCAAGCCCGAG
TGTATCGAGAACTCGCGCAAGTTCAAGCGCGTGCTCACTGCGTTTTGCGACCATTTCCGGAAAAGCCTTAACAGCACGAATGGCGCCATTCCGCCCACGA
CTGGCATCATGTCCTCGTAAGTATTCCCCCCTCACCACCACACACACAAACACGCAAACGAATGAATGACAAACCACCACCAAATGAATGAAACCATTTG
AGCCATGAGATACAGCAGCACATGAGTGCACACTACTGAATCAAAAGAGCACGAGGCACAACAACACACTGGAAAAAGCTGCCAAGCTGACGGCGAAATT
GCGGCTGTGATGCATTAAAAAATGTGGGGCTCCTGCGTCGACAGAAATGCAGAGATTATAGACCATATAGAGAACAACGCCTTAAAGGAACGGGTTCCCG
GCGTCCTCCCACGTGTCCACGTTGTTGTTCGTGAGCACCGTGAGCAAGTGGCCATTTGGCGGACGGGACGAAGGCGATGCATTGGACCACTCCAGGATCT
TGGCCGCGATCGCGTCTACTTTGGTCCAAGACGCGTAGTCGGCGTCCGCCATGAACTTGCGGTTCATCGGCGTGTCGATCGTCGCAGGCAACACGCCGAG
CGCCGTCGCGTCCTCGGGCAGCGCGTCGATGCTGCTCGCAATCAAGTGGTGCGTGCCAGCCTTGCTGATCCCGTACGACACCATGCCAGGCGTAGCTAAA
TTGTTAAAGGATAGATATACGGATGTTAATGCTCATAAATGCATAAAACCCACACGAAAAAGACAGCAAAACGTACCTTTTAGAGCAGCAGCAGCGCCAG
TGAGCACAAGCAGCCCACCGGGGTTCAGCACATGGCTCGCGAGGTGAGCAGCTACACATGCAAACCACAACAACACCATGAGTCGCATTTGCACGAGCAT
GCCAAATAGTAGATGGTCGTACCCATGACAGCGGATTCGGTGTTGCGCGAGTGCATCTGCGCGAGGTTCACGAGCGTGTCTGCGTCTTTGATGCTGCCTC
CGGCCCAGCCGCCAGCAGCGCACACGACGGCATCCACTTGACCATACCTGCACGTTACCATCACGTCAGATCACCACTACCTCGCATGCAAAACGCACAT
GAGCACAACTCAGCGCGTACGTGTCCTTGATGTGCTGCAGCACGGCGCTCGCCTGCGTCAGTGTGCTCGACGCCGCGCGGTCAAACACGAAGCTCGCGTC
GACGTCGTCGTTGGGCGTAAAATCCACTGAGAGCGTCTTCCATGCGGATGCGCGCGTAAAGTGCGCGCCGATGCCACGTCCGAGCGCGCCGGCACCGCCT
ACTACCACGAGCTTCTT