Description :
From Genome Similarity Track
Location :
Scaffold_32:98642- 103021
Transcript NameFunction/comments
Phyra_78482serine protease family S33, putative
Phyra_78483Hypothetical protein

Sequence
4379 bases(100 bases per row)
CTTCGCGTTCCTCTGTCAATGGCTGCAGAGCCGCTTCCCTGAGCTGCACGCCACTACAACATGATGCTGTCTCTGGAAGGCGCAGACATCAATTCATCCA
AGCGGCAAAGCTGCCTGTGTATATAAGCAGTAGGTGATAGGATTCATTCACGAAGCATGCACCATCTCCGATTGCCTAGCAGCTTCTCCCTGTGGCTTCA
CTGTCGTTCTTTCCCACTGCTACCGTCGTCTACGCAGTCCTTCTTGCTCTTGCAGCTTCGTAGCTAGCGACCGCGCGTTCTGCATGAACAACCCACTTTG
TGCGTCGCTGCAGCTCCGAACCTCCTCAGCTCTTGCCATAAAGTCCTTTAACGCTGGAGGCGGCGCGGAAGCGCTCAGTCTCGTTGCGTTGGAGACGAAG
ACAGCTCGAGTGAACGCGTCGTGCGAGTGTTTCTTGGCCGCCTTCATGAATTTCTGCCCGACTGCACCGAGCGTCCCGGCTGACGTGCCCGCATTCAGCA
ATCGCTGTTGCGCTGCGAAGCGCAGCTCGTCCTCTCGCTGTTTAGCTCGCGCGCGACGCCAAACCCGCCACAAAATGGCTGTCGCAGTGGCGAGGCCGAT
GCTAAGCCACCCCAAGTAGATCATATTGAGCGACCGCGTGCTGCTTTCGCCAGCGTTGTGCAGACGGTGGACGGCACCCAGTGAAGCCCAACACGACGCC
GCATATACGCTGCACTTGACGTACTTGATGTACCAGAGAGAACAGCTATGCATAGTCAACGTGAGCGCCAGCAAGACCCCGTTGCCTATGAAGCCGAGCG
AGGCTAGTACCAACGGCTCGAAGGGGAAGAAGGCCTGGGCCGTGGCAGCAACAGCCTTGACCAACTGTGTCACAAGCAGCAGGACGGGGGCGTACTTGAT
GTCCAGCGTCTCGCGCTGGAATAAAACCTGACTCATGCCATGCGCCAGCAGCCCGATAGGCAGGAAGAAGGTGATGCCCCAGAGGCCGAGTAGTGCGTAC
CATTGATGTGCAGCCGTCCAGCAACTAATACTCGGGTGAGCGATTAGAAATGGCGGTGCCTGAGGAGCAGAGACGCACTTCTTCACGGTCGAATGGTGCA
GGGTGGAGCAATCGACACAGGCCAGGAAGGAAAAGAAGGCCGAGATCGTCCCCATGTAGAAGAACCCGTTCACGAGTGCAGGTAGATCTTTGGTCAACAC
GCGATGCAGCAGCACGCTCGTGTCTTGGAATTTGTTCGCACATTTCAGCAGTAGGAACCATGAAAGCAGCAACAGCAGAATGCCCATCGCCTGAAGTTCT
GAGGCCGACGAGACGCCAAATCTGGTGATACCCTGACGCCCAAGCCACTGAATGAAACCTGGCAGCTCGTCTGTGTCATCCCAATCAACCGCGGGGTCAA
ATGCTAACGAATTCAGTTGTACAAGCTCCACCGCGATAGCGGTCACTGCTAGTGCGTTTTGGTAGTATCGCGATATGGGTCGGAGACGTAAACGACTTTG
TTCTAACAAAACGAAGCGGTCTGGAGACACACACACAACTTGCACGTTAGAAAAGCTCAGTAGTATCAAACAAATTGAGAGGACACGTACTGCGCGCGAT
CAGAGCTATGGACACCACAGATAGAATGAAGATAGCGATGCCGTAGCTGTACACGATTCGCGTCATAAAGGTGTTGCGCTCTGAAGCGGCAGTAGAAGCC
TGGTCGTCACTCGCAGCGGTCGGAAAGACCAGAGTTGGGAGCCACAGCGCCATGACGACACTCAAAAGTGTCCCGCCAAGTGCGTATCGCCGCTCTTGCC
ACAGAAGAAGCCCCAGTCTACCGCTGGATGGCATCCACACTCGAAAAAGCTCTCCAAGCCCTTTCCTGGCGTGATACAAACGATAGTATTCGTCACGTGC
ATGTAGATCATCGAATGCCCGAGCCATAATAGGATCCTTTAAGTCAGTACGCAGCTCTTCCTGCCGCCAAAACGCGATCATCAGCACTAGACGTGCAGAG
AGCGAGATCGCGACGCGCAGAGCCCAATCTGCAGCGTTGCGTTGGCGTTCAGTGCGATACTGCGCCAGTCGCTGTGATTCTGTTAACCAAGTCCATGGAT
GGTGTTCTTTAGCTAGGGATTCGTTCTTTTTACGAAGAAATCTCATTGCAGCATCGTCAGAAAGAGGATCACGGCTTAAAATGCCATCACAAACGCTAAG
AGCAGATTGGGGAATGACCACCTTCGCCGCAGGAATCGATACGCCAGCAGCTTGTGCGGACAGTAAAGACTCTTCTTGTTTCCCTTGATCCGCAATAAGT
CGGTTCTCTTGCGATGCAAGGAAGAGTCTGGTACTACGACTCGTAGGGTGTTGTGCCAGCATCTCCGCCCCAGCTTTTAATTTACTCGGTGATTCACGGA
AGAGTGCTGGTTTCTGTGGCGAGGTATGGAGAGAACCTTCTAGCAAACGTTGCCGTCTGGCCTGGTCGCCAGTCACAAACCGCTGTACTTGTTGATATAG
GTGAAACAGCCTTACGCGTTGGATAGGGCGTATCATCAAACGCCACAGACTCATGTCCATTCTATCGTGAACCACACTTGGTAGAGCTGTGAAGGGCATC
TCATCCTCGAATGCCAACGCTTCAAGTCGCGCAAGAACGTCTGGCATCGTTTTCGCAACGTCGAGATTGTGGAAATGTTCGGCCAACTCAAGCACGGAAA
GTCTATCCACCGATTCCTCGCTAATACCGAGCGCCACACTCAGCACTTCCGCTACCATATTCTTGCGAGCTGCTTGTTGTAGTAGCTGCTTCGTTCGCTT
GGCACTCAGCGATTCCCAACCAAAATGATCCAAGGCCAGTTCGAGCGAGCTGAAAGGAAGACGGGATAGCAACTTGTCATGGTTCAAATATGCCAGGGGC
GCTGGGTCTCGGTCGCTGCCACTTTGAGATTGGTCAGTGTTTCCAGAATTTGAGTCGAAGCGTGAGCTCTGGTGAGCTGATGGGCTGTCGAATCGCAGTG
ATTTGGCATTCTGTTGTCGGATTCCTAACCGAAATACTATCAGAAACACTGCTCGCACTAATTTCTTAGGCCGACACAGAGCCTGGAAGATCCCAACTAG
TTTCTCCGTGATCTTTTTGAGAAGGCTGACCGATTCCTTCGACGTCGCCATAGCTTTATCCAGTGAAGTAGCTCCCATCATCCGTCGCCACACGTAGGTC
ATAGCGACGAGTGCTCTAGAGAGATTTTCCATTCCTTCCGGTGACCCTAGAAGGACCCCCAGCGAAGCGGATATCTGGGGATCTAAGCGCCTTAGACGCT
CTCGAACGCGTTTTGTTTGGTCAGCGACGCCCGTTCCACTTGCTGCCACCACTCTCAGCTCGTTTCGATTCGTGGCGCGCTTTAGCAAACGGTGAAGGTT
ATCAAGGAAAAGCATGAGCGCTTGCTGTCGTGAATGGGCTCCAGCACGCTCCATCTTGCGCAAAAACATCGGCAGATCTACAATAAGAGAGCGAAATTGG
CGCGCGATCTCTACATAGTACGACGCATCAAGTTCATGCAGCCCGGAGCAAAGCAGGCCTGCAAGCTCTTCAAGTAGCAGCAGCCATTCCAAGAACGGAG
TAGCACTTACTCGCTGTGCAAAGGGCTCGTTTGACTTGATCTGACCTCTCTTCTTCTGGTTCTGCAGTCTCTTTGCTGTGTCGATGTAAAAGTCGAGAGC
GATGCTTGCCATCGCGTGAAAAGCCACGAGAATTCTAGCGTTCCGAGTAGCAATTCGGATTGCTGCAGTCATCGCTTTTTTCCTGTTTACGGTAAGAGCG
GACAGTATCTCAGAGTGGTCAGTCGTGAACAGCAACAGCTCACGGAGTTCCGACTCCAGTCTCGAGTCTTCAGTTAGCAAGTTCTTGTTTGAAGAAATGA
CTGGACGCTCATCACTGGTACGCTGTACAAATGATTGACGAAGCCCATTCCCTCCAATTTCATCGAGGTGCCATTGCGGTTTACCAGTTGGCAGGAGGTG
CTCCTGATCAAAGCGCTGGAATGCACCACTACACTGCGGTGGAATTATACCAGTACGAACACCAGCTCGAATACTGGAGTAGTAGGTCAGCCGAAGGACA
TTCAGTTCACTCTGAAAGTCGTACCGCGTTAGCCCAAGACACCGCCTCAAGCCCAGTAAGCACTGCTCTTCGTAGGACTTCCCAGTATTTGAAGGGGAGC
TGCGCGAAGACCGTGCATTCACCAGCTGCAGCAGAGTTTGCTCAAATGTCCCCCGATCTGGTAGTTTCTCCACGAGAGAAGCCAAGACGCACGCTGCTAG
GCGGTCAAAGCTGTCAAAGGCCATTTGGTCATCAATTTTGCTAACAAACGTCTTTTCATCGCTTGCTGGATGACCCAAA