Description :
From Genome Similarity Track
Location :
Scaffold_115:98621- 100027
Sequence
1406 bases(100 bases per row)
GAGTATAACTTCGAGTTGAAGTACAAGAGGGGACGGCTTAATGTAGTGGCTGACGCGCTATCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACAGCTG
TGATGTCATCAATGCCTGACTTAATAAGCGCAGCGTATGCACACTACGACATGCTGCGTGCTCTAAGGAGCGAAGTGTTTAAAATCTATGACAATAAAAT
GTCTGGGTGCTTACGCGCGAGGCTGCATCGATATACTCTCGATGACGGCCTGTTGCATTACAGTACTGACCCTGAAAACACTTCTTGTGTGGTAGTTCCT
TAATGATGAGGACCTCAAGTATCTTATCCGCTACGAAGTACATGATACGCCCGTTGGCGGGCATCTAGCTTTGGCTCCGTGGGCTCGACGTACTTGTGGC
CCAACCTGTACAAATAGGTTGGAATCTATGTGCGCACGTGTGAGACGTGCCAACGGACGAAGTCCACGTCAAATACGGCGGCGCCGTTGACGAGTTTGCG
CGTCCCCACGGGATGTTAGCATTCCATCAGTATGGATTTTGTGTTTGGCCTTCCAAAGGCAAAGCTGGAAACACTGGTAACGTGGTCTTTGTAGACCGAT
TGAGCAAGATGTCTCGCTTAGCGGCAGTGCCGGACACCATCGATGGTGAGAGTATAGCTTTGCTGTTTCTAGACAGAGTCTTTCGCCAACATGGCTTGCC
TTAGGCAATTGTCTCGGATCGAGACCCGTAGTTCACCGCGAAGTTCTGGACGTCCTTATTTAAGATGCTTGGCACCCGTATGGACATGTCCACAGCGGAT
CATCCACAGACCGATGTTCAAAATGAACGCGTCAATCGCGTTGTGGAGGTTATACTCAAAAGCGTATGCACTGAAGCGCCGCTGGAGCGAGATGCTCCAA
CTCTTTGAGTTTGCATTGAATAATGCGGTAGATGTCTCTACCGGCTTCACCTCGTTATACGTGAGTGGCCTTGTGAATCCTCACGTCCCGCTAACGCCGC
CACGCGGTGGCTCAAGGCTTGGCGTGGGAGGAATAGCCGAGCGGCGTGCTGAGGTCAGCCCTAATGCGGTACGCAAGCAAGTCGATGACGTTGTCTCGCT
GAGTCTTAGCGTTATGCGCCAGGTGCGCGACGCTATAGCTGAGAGCCAAGACCTGCATAAGGAGCAATGGGATGCTCGAAGCGAGGAAATGTAGAAAGGT
TTGAGGTCGGAGACCTCGTTTTATTAAACGCGAAAAACCTACCTACACATGCAGTGTCTGCTGTCTTCAAGACAAAACTAAGACTTGGGTTCATTGGACC
GTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTACACGCAAAGTCTTCCCATAAAGGTGCGTACCCATCCGGTGTTTTACGTTGGCTTTCTCAAGCCGTGC
CAGGAC