Description :
From Genome Similarity Track
Location :
Scaffold_1597:986- 2454
Sequence
1468 bases(100 bases per row)
TAGCCCCTTGGTCAAACTTGTAGAGCAAGTCAGCACAATTCAAATCTGACAGTGAAACCCAAGAGGGTTCTTCGTAACCAAGCCATTTCACCAGGTATTC
TTTGGTTCTCTTGGATGTTCGAGTTCTTTTCACCCACCTCACATCTAGAATCTTCTCGACTTCGAATTCCCCGGCAGTCTCCAGAGGCTCCCAACTGTCC
TCGGGCAAGAGTGCCGCGTCGAACTCGTCGTCTTCATCAATCTCGAGGAGTCGGAGTGTGGGTCTTTCAGGAATATGAATGCGGGCCTTCAGCCGGCTGA
CATGAACCCATGGAAAAAACCGATATTCAACTCCATCCACCTTGAGCTTGTACCGGAACTCGTTATCGGAATCCTTCTCCACAGCCCGTGCCACAAATGT
GCGAGTTTCTTCGTGAGGCCTGGTCGAACTCGGGGTACATACACCCATACCGCGTCTCCAACTTAGAAaCTCCTAGGgACTGTGTCTGGCAGATTCTGCA
CCTGGAGATTTCGGACTTCCGCTCGGGCTTCCTTAGCTTTCATTTGTAAATCTCGAGCCCAGGCCCGGACATACTCGACTTGACGCTGAACGTGGATTCT
CCAACGGTATGGATTGACGAGATCGCTACGTGTGGGTGCTGGACCGAACATGGCAGCCATGGTCGATTGGGCGTCCcACCCATGCACcAaGAAAAaTGGA
GTTtCCTGGCGGGTGTAGTCGTAAGACGTGTTGAGTGCGAACATGAGCCTTTCACAAACCTCATCCCAGTcACCTTGGGCCGGATCTTCGACGTAAGCTT
TGATGGATCTTATGACAGTTTGAACTGATCGTTCTTGTTGCCCATTTGCTTGGGGCCTGTACGCCAGAGTAGCTACTTCCGATCATCTGCCTGAAAGCTC
GGAAAACTTCTGACATAAATGATGGTTCTTGGTCGTGCCGGATCATGGAACTCGCACCAAATCGCCTGAACACTACTTCCTCGTAAGCTTCGGCCACATC
TTGGGCTGTTGTCTCGGACATCGCCTTGTACATCACAAAACCCGAGAACATATCCTGGAAAAGCAACAAAGCCGTATTCCAACGATCGGTAACCGGTAAA
GGCTTGACAAAGTCCATGGATACTACGTGAAATGGATACTCCGGCATGATGTTGCCTGGGGGTTCTCCCGGATTTCGGGgTCTTCCTTTTCCACTCACAC
AGTCGACGCATCTTCGAACAAAACTCTCAACATCCTTGAACATACCGATCCAGTCGAACTTCCTTGAAACTTTCTCAtATGTCCTCCCGACTCCTTGATG
TCCACCTTGGAAATCCGAGTGACTCTCTTGTAGAACGTCATCCCGCATCGAGTGTGGAACCACAACTCGGGTTTCTGGGGTCCTACCAGTGGGTCGTCTC
GTGGAGACTGGAGGTACGTAGAGTAGCTCTTCTTCTTCATCTAGAACATATCGTTCGGAGATTTTGGC