Description :
From Genome Similarity Track
Location :
Scaffold_137:9856- 13023
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_137-snap-gene-0.14Pro-apoptotic serine protease nma111

Sequence
3167 bases(100 bases per row)
GAGCGTCAGTTGAGCGCCCGGCTTGCAGCGGAACTCGTTGCCGCCGAAGCCAAGCACAACAGCGTGGATTGGAAGGCTACATTGGAGCaCGTGGTGCCGG
CcATCGTGTCTCTCAAGCTGAACAAtCCCAAGGTGCGTTTaCCGGGTCCaTATAGTGGTTGCACGTTGTTCCTCATGTAGGTTGTATGATAGTTCTTCGA
TACTGAGTCACCGGGAAACGGGTCTGCTACGGGATTCGTCGTTGATGCTGAGCGTGGAATCATTCTCACAAATCGACATGTCGTCGGCCCCGGACCAATC
GTAtGTAGTGTTCCGTACGCTTCTGCATGGGACGGGAAAATAGTCTCACGTACCGCACTGAGTGACAGGATGCCGAGGCTGTCTTCCAAAACAACGAAGA
AGTACGAGTCATCCCGATCTACCGTGACCCAGTACATGACTTCGGCTTCTTCAAGTACTCGCCAACAGTGAGACAAGCCCCAACGGGTTGATTTTTCGTC
TTCATTGCTGCTGACTATGTTATGTGCAGGATGTCAAACACATCAAGGTTCCCTCACTTCCACTGAAACCTAAAAaGGCCAGTGTCGGCACGGATATTCG
AGTCGTGGGAAATGATGCCGCCGAAAAACTTGCAATCGCAAGTGGCACGCTTGCTCGGTTGGATCGCGACGCACCAAACTACGGCTTCAATAGCTACAAC
GATTTCAATACCTTCTACTTCCAGGCGTCGTCGGGTACTACAGGCGGgTCATCTGGCTCTCCAGTTCTCAATCATGATGGGGAAGCGGTAGCTctAAATG
CCGGTGGGAAGATtGGTACCGCCGCATCATTTtATTtGCCCCTTGACCGCGTGAAGCGAGCACTGGAGTTGATTCAGAATGGTGAGGATGTCCCTcGAGG
TACCATCCAGACAGTGTTCCACTACAAGGTGAGAGCAATCCCGcATTtCATTGATGGGTCgAGTCTAACGaGATGATGCCCAGCCTTTCGATGAAGTTCG
CCGTTTAGGAGTGACTTCGGAAACTGAATCATTGGTGCGATCGACCTCACCTCTCGAAACTGGTATGCTTGTCGTCGCTGAGACTGTTCCAGGTGGTCCG
TCCcATAAGATTCTCGAGCCCGGCGATATCCTGGTTCGCGTGAATGGTGAGCTGGTGACTCGTtttGTCCCACTTGAAGCAAttcttGATGACAACGTGG
ATAAGTCGGTACGTTGGTGGATGATGGCTGCCcATACTAATTACTTTGTGCTGACTTGTCTATCTGcTCCCCATTAGATTGAGGTGGAATTtGAACGCTC
CGGAAAGTTGATCAAGAAaGAAATGCAAGTGCAGGATCTCCACGCGATCACTCCATCtCGTTTCCTCGAGATTGGTGGTGCTGTGATCAACCCACTTTCG
TACCAACAAGCCCGTAACCActCATTGACACCTGGGGCTCCGTATGTCGCCGATCCGGGCTAcTtCCTGCAGCGTTCTCACATCGGTCGCGGTGCCATTA
TCCGTTCTGTGAATGGAATTCCAACCCCAAACTTGGACGCACTGAAAGATTTCCTCATCAACACTGTCGATGGTGAGCGCGTCGTCATCAAGTAcTCGAT
GATGTCTGAGAAATCCGAACGTGTCGAAGTTGTTCACATCGATCGGCGATGGTTTCCGTTCTGTGAATATGTGCGTGATGATAAGGAAGGCACTTGGCAC
AGTATCAATCTTGACGACGTAGGCGCAACAAAAATGGTCGAGGTGAACAATGACCAGCCGCCGAAGAAGAACGGAACacaCCCAATCGGATCGACAACAA
CTTTACCAGGCAAGAACAAAAtcGAAGCAAAGCTGGCTCATTCGCTCGTGACCGTTGACTACGACAGACCGTTTAGTGTAAACAGTCTAGCGACTGCAAA
CTACCGTGGTACAGGTCTCGTGATCGACGCTGAGAAaGGTCTTGTTGTTGTCGATCGCAACACTGTAACGGATTCATTGGGGGACGCAATGGTGACGTTT
GCAAGTACGATCATGGTTCCAGCTCAAGTAGTGTTTGTGCATCCAGTGCACAATTTCGCCATAGTTCAATATGATCCGAAGCTCATTGGCTCAACGCCTA
TTGAGAGCTGTAAGATATCCAAGAAGAAGATTGAGCCATCGGACCCTGTATGGCTCGTTGGTTTGATCAGTAGTGTTGGGCGCAGTGGACACTCCGACTT
GGTGTCACGCGAGACTATCGTATCTGGGGTAAAgTGGATTGGCCTTCcGATGCCTAGTCCTCCACGGTATCAGGAGCACAACCTCGAAATGGTTGCCcTA
CAAGACGTTGTAAACACagAAGGAGGTGTAGTGACTGACCCGGAAGGTGAAGTACAAGCGTTTTGGGgCTCATTTtCATACCAGCAACGCCGAAACGGCG
GCAAGGTGgAGAGCCAATTCAGTCGAGGAaTTCCAATTGACATCATCATGGATAGTGCAAAACCTCTCATGGAAGGCAAaACTCCTGAATTGTGGGATCT
TGGTGTCGACTTCGAGCAAATCAGTCTGGCGAAGGCACGTGAGTTGGGTCTCGAACAGTCCCTTGCGGAAGTTTTGGAACGCGATGCCCCGCATCGACGA
ACAATTCTGAGTGTTGTTCGTTCGTGGGGTGGCACCGAAGCATCCAAGGTTCTCAAAAATGGCGACATTCTTGTCGCCATTGATGACAAAATCGTGACCT
CGTTCCGTGAAGTGGAAAAATGCTGCCAAAAGCCTgAAGTTACCCTGACGGTTGTTCGCGATGGCGAGGAGAAGCGCATCGAAGTCAAGACGCTGCTGAT
GGAACGCACGGAGATTAATCGCATtGTGTTTTGGCAAGGTCTGCTGCTTCAAGCACCCCCATTATCGGTGTCCGCGCAGCGCAGCATTTCGCTTGACGAT
GGAGTCTATGTGTCATGCCGCTACTCTGGCTCACCGGCGGCACGCTACGGCCCGCCACCGACAAGCCGTATCAAAGAAaTTGATGGAGTCAAGATTACAA
GTATCGACGACTTCATTGAAGTTGTGAAGGCCAAGGCCGGAAGTGATTCAgTGCGTATcAAGTACACGGACCTCACCGGGAAGGACCGACTGAGCACGCT
AAAGCTCGAGCCCAAGTACTGGCCGACGCGCGAGTTGCTGCATGAAAACGGCGAGTGGCACCGTCGT