Description :
From Genome Similarity Track
Location :
Scaffold_265:9856- 10945
Sequence
1089 bases(100 bases per row)
GTACACTCTGCGACACAACTGATCACCCGGGGTCGTTTTGGTCCGTAACGACGTCAATATTTCGAGTTAGCAAGTGCTGTTTGGATATGTGCTTGCTGTG
CTTAGCAACACTACGCGGTTTGTGCTAACGAGCGCAACTTCGCAACCTGCGAGGTACCTCCCATACAACTTTCTACTTTTACCTTCGCGACACATTAAAT
CACTCGCTGTCTACATACAGAAGTCTAGTATAAAATGTTGGCCAAAATCAGTAGTGAGTCTTATTACCCTTTCTGTCTAGCAGTTCAACGCATCGGCGAG
GCATCGATTCGATGAGAGACTGCAACAAAGCAATTGGGGTATCATCCCAGCCTTTGAAATGCGCTGCCTTCAATTCTGGCACGCTAATGAACTGTTTGCC
ATTTCCATAGACTTTCCTACTTATAAAAGCCCACAAGTTTTCAATAGGATTGAGGTCGGGCGATTTTGATGGCCAATCTAGAACAGCTATGCCCTGCTCT
TCAAAAAAAACTCCTTCGAGCGATGAGAGACATGGATACTAGCGTTATCTTGTTGGTAGATAAAATCTATGCCGTAGTTTAGGTGTGCAAAGGGGAGGAG
ATACTCAGACACAGTGTGGACGTAATCGTCTGAGTTCTGCCTCCCCGTCAGCACGACAAGTGAATACTTGCCACGGGCGCTAAAAGCAGCCCACACCATA
ATCGAGCCGCCACCAGCCTGACGCCGTTTAGTGCAGCGTGGTGGCTAGCGGACATCTCACCAGTAATACTGGAAGCCGTCGGGGCCGTCCAGGTTCCACT
TCTTCCCATAGGAGAAGATGATGGACTCCCAGATAGCCCCGGCGTCTTTCTGTAGCAGCATGGCCCCCGCCCAAGCCTTGCGCGCCAGCATGTCTTCGGC
CTTCAGAGGCAGCGTGTTGACCATTTTGGTATACACCAACCAGTCTACCCTAGCGAGGGTGCGCTGAATGGTGCGTACCGTGACAGGAAGGCCCAACTCT
TCCTTGATCTTGGCAGCAGAGAGTTCCCCCTTGGCAGCAGCACGGACGAGGCGGCGAGTCTCGCGTTCAGAGAGGGCGGGAGCACGACC