Description :
From Genome Similarity Track
Location :
Scaffold_270:9853- 14760
Transcript NameFunction/comments
Hyaar_Emoy2813389hypothetical protein

Sequence
4907 bases(100 bases per row)
AAGTTGCATTTGCCAAATCGAATTTGTCAGGACGTGCTAGAACTTGGGCCCTAAATCTTCAATTACACGATCCAAACGCGTTTGAATTGTTGGCGGTCTT
TAAGAATCTGCTCAGCCAAACGTTTTAGCCGCCAAGAGCTGAGCTCAGAACTCTTACAGAGATCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCT
TATGCTCAGCACGTTCGTTACCTTGCAAGTTGCATGGTAGCGAACACTGTAAGTGAATTCGTGTTGATCACAATATTCTTACAAGGCCTCATAGATGGTC
CCGTGAGGAACCACCTATTCCTCATCGAGTTGAAGTCGTTTGAGGAAACGATTACAACTGCGGTGCAAGAGGACTTTAGTCTGAGACAGGCTCAGACTAG
CTTGAACCCTTATCGTTCTTCGAGACGAGTAGAGGCGGGAGATCCAGAACCAATGGACCTCTGCAGTGTCGAGAGCGAGAGACCTCGCTCTTCAAGCAGT
AAGCGATTACAAAAGCGCAATCGCTGTCAAAAGTTAGGACACTACGCCTACGAGTGTAGTTCTTCACGCCCAGTGTCTCGTAACTCCGAGCGAAGTGATC
GACCTTCTGCCAAGAAGGGCAACGGACGCGGTTCCGACGCTGTTGCGAAGTCACAACAGCGTGGCGGACCGTCAAAAAACGGTCGGGGTTAGTAGGGGAG
GAGCGCCCTAATGATCCAGCAACCTCAACAGAACTTGCAAATCTATTGATAAAAGTTGCTCCAGACTCACAATCCTCGTGTGTCTCTGCATTTGGTGATG
AGGTACCCCTCATCACCTTGAACTTAGAAGTGAAAAAGATTTGTCACTTCGTGCCTCAGTTGACTGTGGGACGTCGAACAACTTTGTTCGTCGCCAGTTG
CTAGAGGATCGTAGGCTCAGGTTCGTTGAGCGCGTTTCTCCTCCTACGAGGCTGACGGTGCTCCTTGCAACAGGCGCATCTATAGCAGTGATGAAACGTG
TAGTGGGATTTCACTACACGTTTGCAGTACAATGATAATTTCATCGTACTTGATTTTGGATGACAAATTTGATGTCATCCTACGGTTACCCTGGCTCAGA
AGGTACGAGCCAAGGGTCAGCTGTAGGCATCGAACCGTGAAGATGCCTGCCACTTGTTCATCAGAAGGATATCTGATGAACGTCTTGGAGCGTCCACAAG
CGTGTGGATGTACTGCGAGTGAGTGCGATGACCTCACTTGCGATGACCTCACTTGCGATAAGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACAAC
CAATCACACTGTGGAGGAAGATGCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTCGAATAAGTCGAGCCGATCGGACATAGGTGTA
CGCCTAGCGGGCGACACCCAAGTAATAATAAACCAGTTGCCAACACGGGGCAACACGATGATCCTAGATCGACTGGAGAGCGATCGTAGAGGACCTAGCT
GTAGTAGCGCAACCACATCTAGAAGACATCGAGGGAATAAGCCCCCATCAGCATGTGGAAAAGGGTTACCAGGAATAAACCAAGACATTGAATGTCTTGT
TTAATGACGGGTCAAGTGTAGGCGCTTACACACTTGATCTGATCGCACCTCCGAAGTCGACTTCGGAGATCACTTAATTGCCAACGCTAGAGCCAAAACG
GTTCTTGCGAGATCTGTGACCAAGCAGATCTTCGTACTCGTCGCAGAGGACGAGTACGTGACCGACATTCGGTCGGCAATAGTATTCGCCTAGAACGAAC
GGGTTCTCAGCAGCTCATCGATAGACGAAGGTGTCCTCGAAGAGAAGACTCGGATTGAGAGACACACATCTCAATCTTGGGAGTCGCTTCAGGCAAATTC
TTTATATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGGATTGCCTAAGGGTAAAGGCACTCGACATGAAATCGAACTATAA
CCGGGCTAGAAGTACTGTGTCATGAAGCAATGGTCACTGCCTCGTGAACAAGTACTTACGATCGACAAGTTCTTTGCCGATAGCTTAACTGCGGGTCATG
TGAGGGAGTATACTTTCCCTCACAGCTGTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATAGTGCATGCCTTCAACAAGTTGAATGCTGC
AACGGTACCGGATCAGACGCCGATACCGAGGAAGGAAGTAATCATTTATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTC
TATCAGATCCTAATGCGTGAACGGAACATCCCGTACACAGCAGTAATCACCCCGATCGGCATGCTGTGGGAGTGGCTAGTAATGCCACAAGGGCTTAGTA
ACGCCCCTGCCACATTTAACAGATGTGTTACAGATGTGTTGAGATCGGTGCGAGACTTCGCACCGAGTTACTTCGACGATGTATTCGTCCATAGCCGGGC
CATGGGCGGAAAGACGGACGTAGAGGTTCATAGAACTCACGTTCGTCAGGTTCTTACACTTATGCGCAAGCATAAGATGTACGCCGACCTCAAGAAGTGT
ATATTCGCTGCCAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACACGGCATACGCCCTGATCCTGAAAAGATCAAGGAGATTACCGACTGGCCTG
TGCCAGTCGACATTAAGGGAATAAGAAAGTCCCTTGGTCTAGCGGCGTACTCACACAAGTACTCGCGCAACTACGCTGAGATGACCGTTCATCTCTCTCG
TCTCTTGAAAAAGAATGAGAAATTGTCATGGAACGCTGATTGTCAGCTTTCCTTTGAAGGTATCAAGAAGAGCTTGATGCAATCGCCCATCTTGGCGATT
GCAGACCAAGACAGACCATTCCATGTGGTCTGTGACGCCAGCAACTTCGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACGGCGCAGAGCGTGTCG
TCTGTTATTAATCGCGTCAGCTGCAACCAGCTGAGCGTAATTATCCAGTGCACGACAAGGAACTCCTTGCCATGAAGTACGCACTAGCAAAGTTTCGCGT
CTATCTCCTTCGAGATAGACCATTTGTAGTCTATACGGACCATGCGTCTTTACGCACGGCTGTAAACAGTCCACACTTCTCCCAAAGGATGGCGAGGCGG
CTGTCTTTCTTGGCGGAGTATAACTTCTCCGTATAGTATAAACCCGGAAGACTCAATGTCGTCGCGGACGCGTTTTCGCGCCGACCCAATTTCGGGTCGG
CTGCACAGTCCAACAGTGAGGTTGATACCACTGTTGCAATACTAGTCACTAGTGTTCCGTCGCCAACATTGCTTGACGACATCAAAAAGGCCTACGCAGA
AGATAAGGCTCTTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTAAATCTATCAAGGGTTTACCGACCTTGTATCGATCTTCCGCGGATCGATGC
ACAACACGCAACGGGTTGCTGTCTTATACAGCCGTTACCGGCTACACACCTCGTGTCGTCGTCCCCACTCATAATGATTTGCTCTTACGCATCATGTATG
AGTGTCACGATGCACCAACTAGTGGGCATCGTGGGTTTGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGTG
CAAGTACATTCGTGCTTGTGAAGTGTGCCAACGGGTGAAGCCTAGCCCTTTATCCTGTGCGCCCCTACAGCCTCTAACAATCCCGGAAGGGTGCTGGCAG
TCCGTTTCAATGGACTTCGTCTTCGTTTTCCCCGAAGATGCTAACAAGAATAATGGTATTCTTGTGTTCGTAGACCAATTCAGCAAGATGGTACATCTTG
CTGCAGTTAACGAGTCAATCTCAGCACACGGTTGTGCCCGTGTCTTCGTTGACACTGTATACTGACTCCACGGTCCACCCCGTGAACTAGTCTCTGATAG
AGATCCTCGGTTCACGGTGGCGTTTTGGTAGTCTGTGTTCCGATCCCTCGAAATACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCAG
ATAGAACGCGTCAACCGCGTCTTTGAAGAGATACCTCATGGATACGTCCATTTTTTCATATATTGGAGCGATTTTTTGCCGGTGGTGGAGTTTGCTATCA
ACAACTCCGTGCATGCATCGACAACGGCTTACGCCATCCACGCCTACCCACCCATTTAGAGTGTGACACTAATTCAAGGGGGAGGGATTCACTCGAGCAA
AAACCGTTCTGGCTCTTGCTCATCACGTGTCGAGGTAATCGACGACGCAAACGTTGCCGTTGTATATCAAGTCGACATCGAAGACGATAACCTTATCAAT
AGTGATGATACTATTGCTGACCCAGATGAAGATGACGATGTCAGTATTTTTGGCATCGCCAATGACTACACCAGCGAAGATGAGAACACCCTCACTGAAG
AAGAGGATGACCTCCCAGCGGTGCGCACAAGGTGCACTCCAACAGACCAAAGTGATTCAGCAGTAGATTTCCTGCTGACACGAGAAGCAGTGGTCCGTTT
CGTGCAAGACTCCATCGCTAATGCGGTGGACCGGCAGAAACGGAACGCTGACAAACATGACAGAGAAAATGTTCTTCTATTTATTGTCGGGGACTTAGTT
CTACTGTCTACGGTAAATCTACCTAAGCACGTAGTAACTAATGTGGGTAGTAGTAAACTACTACCCAAGTACATATGCCCGTTTCGTGTACTACATAGCA
GAGGAATTTGTACACGATCGAGTTGCCTCGCAGGATGCGCACCATCCTACGTTTTATGTCGGTCGTCTCCGCCCGTACCATCACCACGTGGTATCTTCCT
CGGGCGA