Description :
From Genome Similarity Track
Location :
Scaffold_835:9853- 12612
Transcript NameFunction/comments
Phyag_g8289phospholipid-transporting ATPase, putative

Sequence
2759 bases(100 bases per row)
GTCTATTTCAATTACGCCCCCGGCAACGCCGTGTTCGACAAGTGCTCGAACGTTGTAGTGACGTCGAAATACTCGATGGTCACTTTCCTGCCCAAGTTTC
TGAGAGAGAGTTTTACCAAAGTGGccaatttcttcttcctcatggTCTGCGTGCTGCAGAGCATCCCCAGTATCAGCAACACGTACGGCTATCCGACCAA
CGCCCCGGTGCTTTTCTTCGTCATCTCGATTGACGCTGTGTTCGCTGTTATGGAGGACCTGCGACGTCATAAATCCGACAATGAAGCGAATTCAGCTACA
TGCCATGTGATCCAGGACGGACAGGTTGTCGACAGGAAGTGGGCGGACATTAAAGTTGGAGATTTCCTACAGATTCGCAATCGAGAAGTCATCCCGGCTG
ATGTGTTGGTGCTTGCAGTCTCGGAGCCTGTGGGGGAACCGCCGAGTGGCATTTGCTATGTGGAGACCAAGAGTCTCGATGGTGAGACCAATCTCAAATT
GAGACAAGCTGTGGCTGCGACTATGAGTTCGCTGTCGAATGCTGCGGAATTGGCGTTGCTGCGCGGTGTTATCAAGTGCGAGCAGCCCAATCCGCACATT
AACAAGTTTGCAGGCAAAGTGGAGGTGACGGTAGGTGATGGCTGCGGTGTTGAGGTCATGCCACTTTCGGTCAAGAACGTACTGCTGCGTGGTTGCAATT
TGCGTAACACGGACTGGGTGTTTGGACTGGTACTCAACACGGGTAATGATACCAAGATCATGCAGAGCGCcagtgcagcgccgtcgaagTGGAGCGACCT
CATGCTGAATATTAACCGCATGATTGTCATTTTGTGCTTGGGATTGTTCGTGGCTTGCGCAATGGCGGCGACTTGCTACATCACTTGGCAATACGATATC
GTGCGGAATACGTGGTACATTCAGCTcacggagacggagaagaaccGCACACGGTTCGTGGCGTTTATCCAGATGATGTTCTActacttcttgctgctct
aCCAGGTGATTCCGATCTCGCTGTACGTGTCGATGACAAGTGTCAAGTTCTTGCAATCGCGTTTCATGTCGTGGGACCTCGAGATGTACCACGCGGAGAC
TGACACGCCTGCTATAGTGCGTACGATGGAGTTGAACGAAGAGCTAGGCCAGATCTCCTACGTTTTCAGTGACAAGACAGGCACGTTGACGTGCAACATC
ATGGAATTCCGCAAGTGCTCCATCAACGGCACTTCGTATGGTTCAGGTATCACGGAAATTGGACGCGCTGCACTGGTTCGAGCTGGAAAGCCCATTCCTC
CGGAGCCCAAGCTGGACCCGAGCATCAAGAAGGTCCCATTTGTGAACTTTGTTGACAAAGCACTGTTCGACGGAATGAAAGGCAGCGCTGGCGAtgagca
gaaggagaagatcatgcAGTTCTTCGAGCACCTTGCCGTGTGCCACACGGTGATCCCCGAGCGACTGGAATCAGGCGAAGTACGTCTgtcagcgtcgtct
cctGACGAGCAAGCTCTCGTGGCTggtgcagcttttgcaggATTCAAGTTTGAAAGTCGTAGCGTAGGAACGGCGATTGTGGAGGTACTGGGACAGCGCG
TGACctacgaggtgctggacgtgctcGAGTTCAACAGTACGCGTAAGCGTATGTCTGTTGTGGTGCGCAAGCCAActggagagctgctgctctacaCGAA
GGGAGCCGATATGATGATTTATCAACGCCTGAAGGATGATCcggcgatgatgaagctcaagaacatcACGCGTGATCACATGGAGAAGTACGCTGACGAT
GGTTTGCGTACTTTAGCACTCGCAATGAAGACGCTCGATGAACGTTGGTTTCAACAGTGGAAGATGCGCTTCGATGACGCCCAGGGCAATGTGGCGGAGA
TCGACCGACGTAAAGATGGCAAGCCGAATGCAATTGATGAtctgatggaggagatcgaggagggTTTGGAGCTGATTGGGGCTACAGCTATTGAAGACAA
ACTTCAGGACGGCGTCCCGCAGTGCCTGGCAAACCTGACGCGAGCGGGTATCAAAGTCTGGATGCTTACGGGTGACAAGGAGGAGACTGCGATTAATATT
TCGTATGCTTGCTCGCTGCTGGATAACACGATTCAGCAAGTAATCGTCAATGCCACAACGTGTCCAGATGAAGCAACGATCCGCGCCAAGCtgaacgctg
cagctcgcgagTTCATGGACAGTGCCAAGGGTATGGCAGGTGGTAGTGAGAAGGAAATCTCGTTGATTATTGACGGTGAGGCACTGGAGATGGCTCTCCG
ACCGGGAACTGCACCGCACCTTTTGTCATTTGCCAAGTTATGTCGCGCTGTTATCTGCAACCGTGTTTCTCCTGCTCAAAAAGCTGAGATGGTGAAGCTC
GTGCGAGACAATATCACAACTGTACGAACTCTAGCTATTGGTGACGGTGCCAACGATGTCGCCATGATTCAGGCCGCTCACGTCGGCGTGGGTATCTCCG
GACAGGAAGGTATGCAGGCTGTGAACTCGAGTGACTATGCGATTGCACAGTTCCGCTTCCTTGagaggttgctgctggttcacGGGCGGTGGAACTACAT
CCGTATTTCTAAGCTGGTTCTGTACATGTTCTACAAGAACATTACGCTTGTCCTGGCGCAGTACTGGTATGGTTATCTCTCTGGTGCTTCTGGCTCGAAG
ATGTACTGGGAGATCGGTGTCCAGCTGTACAACATCGCATTTACGGGCTTACCAATCGT