Description :
From Genome Similarity Track
Location :
Scaffold_39:98491- 100713
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012038Similar to MYO5A: Myosin-Va (Gallus gallus)

Sequence
2222 bases(100 bases per row)
ACGTCCACCAGCTCGAGTCGCTGCCGTACCAGAATGAAAACACGGGCGAGTACGGCATTGAAGATATGATCACGCTCAACTACCTCCACGAAGCTGCGAT
CTTGTTCAACGTCAAGACCCGTTTCCAGAAGAGTCTCCCGTACACGTACACGGGGGATATCTGTATCGCGGTGAATCCGTACCAGTGGCTTCCGGATCTC
TATGCCGACGAGCAACACTTGCGCTACTTGAACCAACCAAAAGAAGAACTCCCACCCCACGTGTATGCGACCTCGGTCGCGTCCTACGACAACATGCGTC
GCACGGAACGCAACCAGTCGATCTTGGTCAGTGGTGAATCTGGTGCCGGTAAAACGGAGACGACCAAGATTCTGATGAACCACTTGGCAACGATCGCCGG
TGGTTTAAACAACTCGACCATTAAGAAGATTATTGAAGTGAATCCTCTGTTGGAATCTTTTGGTAACGCCAAGACGGTGCGTAACGACAACAGTTCTCGA
TTCGGCAAGTTCACACAATTGCAGTTTGATCGCAATGGAACACTGGTGGGTGCCAAGTGCCGCACGTACCTTTTGGAAAAGACGCGTGTGATCAACCATG
AAGCCCCCGAGAGAAACTATCACATTTTCTACCAGGTACGCATATTATACTTCTCTTGTTGTCATTACGAGTTTCAGGTTGCACTGACTTTGCTGTCGTT
TTTTTCTTGCATCTGTTTTGCTTTAGATCTTGGAAGGAGACAGTTCTGCAGAGCTTCTGTTGGACTCGTCCAAGACGTACGCGTACACTGGTAACAACAG
CGCTCAAAAGATCGAGGGCGTGTCGGATGCGAAGCACTTTGAGAAGACGCGCGTTGCGTTGGAGCTGATTGGTCTTACCCCAGACGCTCAGAAGCCGCTC
TTTGAAGTCTTGGCGGGTGTGTTGCAACTCGGTGAGATCAGCTTGCTGTCGAACCCAGCGAATGACGAAGAGTCTTTGATTGCCGAGGGAGATGCCGGTG
CAACCGCGGCCACGCAATTGCTCGGCGTTTCCTGGGAAGCGATTCAGAAAGCGCTTTGTTCGCGTACGATGCGCGCAGTGAATGATGTGTACAGTGTGCC
ATTGCGCAAGGAGCAAGCGATGGACTGCCGTGACGCGCTCGCGAAAGCTATTTATTCCAACGTCTTTGATTGGCTCGTGACGTCGATCAACCAGTCTCTT
TCCGATGACGATAACATGTTCAACCACGTTGGTGTGTTGGATATCTTCGGTTTTGAGCACTTCAAGCACAACTCGTTCGAACAGTTTTGCATCAACTACG
CCAATGAAAAGCTGCAGCAGAAGTTCACGCAAGATGTATTCAAGACGGTGCAAATCGAATACGAAGAAGAAGGCATTACGTGGAACCACATCGAATACGC
GGACAACCAAGACGTGTTGACCGTGATTGAGTCGAAGATGGGTATCATTTCGCTCTTGAACGAAGAATTGATGCGTCCGAAGGGTAACGAAGAATCGTTC
ATGTCGAAGGTGGCGTCCTTGCACAAGGAAGACATGGCGCACGTTATTGAATTCCCAAGAACGTCCCGCACTGAATTCTTGATTAAACACTACGCCGCGC
CAGTCATGTACGATTCGGTTGGTTTCTTGGAAAAGCACAAGGACGCTCTGCTCCCAGACTTGTCGGAGTTGATGCGCGGATCCTCGAAGCCATTCATTTC
GGCTTTGTTTGAACCGAAGCCTGTGCCACAAGCTGCTGCCGTGGATCCCACGGCTCGACGAAAGCGTGGCGGCGGTGGTGCCCTGACGCTGTCCACTGTT
GGTACTCAGTTCAAGGAAAGCTTGAGCGAGCTGATGACCACGATCCAGGCCACGAAGGTGCACTACGTTCGTTGCATCAAGCCAAACTCGATTAAGAGCC
CAACTGCTATGGATCAACAGATGGTTGTGTCTCAATTGCGTTGTGCTGGTGTGATTGAAGCCATTCGTATCGCGCGTGCTGCGTATCCGAACCGTCTCCA
GCACAAGGAGATCTTGGACAAGTTCTGGTTGTTTGTTCCTCGCCAAGGAGAAACTGCGCGTGAAAAGTGCGAGTTGCTGATGGAGAAGCTCAAGTTGTCG
ACTCCTGAGCAATACCAAATGGGTAAGTCTCGCGTGTACTTCCAACTTGGGGTCCTTGAAGAGCTCGAGGATCGCCGTAAGAAGTTCTTGGATGCCAAGG
CGACGTACCTCCAGGGTGTCAT