Description :
From Genome Similarity Track
Location :
Scaffold_35:98491- 99532
Transcript NameFunction/comments
g2648.t1XP_009520546.1 hypothetical protein PHYSODRAFT_354062 [Phytophthora sojae

Sequence
1041 bases(100 bases per row)
ATGTTGCAGCCAATGCGTCGGCTCGAGGCTGCGAGCCACCCAACTGGGAGCCGACCGGAAGATCCTCCCTTTCCTCGACTCTCACTCTCAGATTTTCTTT
GAAGAAGGTAAGCGCTCGCTCCGCCGACACCCGGAAAGATCCCAACCCAGAGACTAATAGCCCTCGTTCTTATCTGCAGTTAACCATGGGCAAGGAAAAG
GTTCACATCTCGCTGGTCGTGATCGGCCACGTCGACGCCGGCAAGTCGACCACCACGGGTCACCTGATCTACAAGTGCGGTGGCATTGACAAGCGTACCA
TCGAGAAGTTCGAGAAGGAGGCTGCCGAGCTCGGCAAGACCTCGTTCAAGTACGCTTGGGTGCTTGACAACCTGAAGGCCGAGCGCGAGCGTGGTATCAC
GATCGACATTGCCCTGTGGAAGTTCGAGTCCCCCAAGTACTTCTTCACGGTCATTGACGCCCCTGGCCACCGTGACTTCATCAAGAACATGATTACGGGC
ACCTCGCAGGCTGACTGCGCCATTCTGGTCGTCGCCTCGGGTGTGGGCGAGTTCGAGGCTGGTATCTCCAAGGAGGGCCAGACGCGCGAGCACGCTCTGC
TTGCCTTCACGCTCGGCGTGAAGCAGATGATCGTGGCCATCAACAAGATGGACGACTCGTCCGTCATGTACGGCCAGGCTCGTTACGAGGAGATCAAGAA
CGAGGTCACCACGTACCTGAAGAAGGTGGGCTACAAACCCGCCAAGATCCCGTTCGTGCCCATTTCGGGCTGGGAGGGTGACAACATGATCGAGAAGTCG
GGCAACATGCCGTGGTACAAGGGACCGTACCTCCTTGAGGCTCTCGACACGCTGAACGCCCCCAAGCGTCCGTCGGACAAGCCTCTGCGCCTGCCCCTCC
AGGACGTGTACAAGATCGGCGGTATCGGCACGGTACCGGTCGGCCGTGTGGAGACCGGTGTCATCAAGCCTGGCATGGTCGCCACGTTCGGCCCCGTGGG
TCTGTCGACGGAAGTCAAGTCCGTTGAGATGCACCACGAGT