Description :
From Genome Similarity Track
Location :
Scaffold_93:98490- 104040
Transcript NameFunction/comments
Physo_141031hypothetical protein
Physo_141032hypothetical protein

Sequence
5550 bases(100 bases per row)
TTTTACGAAACGCTGTTGACGCTGCACCACTTGCTCATGTACTTGAAAAGCTCCGCCAAGATGCAGCGCGCGTCACGAGATCGGCAAAACTACATCGCAG
CAGGAAATCGACAGATTCAACACGGCAGCTACAGCGACGTACCAGCTGAGAAACACACTGACGCACTTGCAGGTAAATTGCTGGAGAAATATCGATTCCT
GATGGACTCCATCGTCGACGTTCGTCTCGTCCGGATGGCTGAGACGTCCGTGGCGCTCGTTCAGTTTGTACTGAATCACTTTGCGACCAAGACGACTGCT
AGTCAGCTGCGGTTGGGACTAAGCGACAACCAGCTCTCTCACGCGAGCAGTGGGGGGTTCTATGACTCGCGAAAGAGGCGGTTGGGTGCGCTTGGATCAT
TTCTTGACGACTATCGCGCTGTGACCGAGAGCAGAGCGGAGACTCGATCGCTGCTGTTTGGTAGCGAGAGAACCATTGAAATGCCGCTCAACACCTTCAG
CTACGCCACCACGGAGTGCACCAACGCGGCCATGGAGAGACTACTGAACCCTGGAATGACAAACCGTCTCGGGACAGTTCTGTCGAACGGATCAATGAGA
CTCGAGTATCTGGACCCCAGCGAGCCGCCGAGTTCCGTTCGTGATGAAGATATCTACATGAAGCCTCTCGAGCCGGAGATCAAGAAGAAACCATCGCAAA
AGGAGATCCACCCAGCTCCACCAAGACAGTTGAAGTACAAGAAGCCCTCGCTGGAGCCACACAAGCACGACACTTATGACAGCCTTGCCCCGGGCAACAA
TACCCAAGTGTACCAGCCGTCACTACCATCGTCCGTGGAGCGTTTAGTGGGCCAGACAAGCCCCACACGCTCCATACGCAGCGATGTCGGGGCAAACCTC
CTCAAAAGCGACGACGAAGACGACACGTTCGGCCCATTGCTGCATAGTGATCACGTTTCAACTGCGGCACGGTCACCACGCGCTATCCGCAAAGCGTTCC
AGGCCTCGGTGGGGGCACGACGAACCGCAAACGAATGTGACGCCTGCATCGGATGCAACGACGTGTGCACGAACGAGAAGTGCTTCTTCTGTGCGGAGAA
GGAGTACCAACTGAAGGTCGCGTTCGCCGGGTCTTCCGTTGCTACTGGACCCACAGTGCGCCAAGCAGCGTGGCAACATCGAGCACCGTCGTCGGTCGAA
AGCTCCTTCAATGTTGAACGGGAGTACTCGTCCTGTGAGATGAAGCGGCACCAGACCCAACGAACGTGCTGGATCCGTGTAGACGACAGCGTATACGACG
TGACTGACTTGCTTGGAGTACATCCTGGTGGGGCACAGGTGTTGCTCGAGGCAGCACAACACGGCGGAGACTGTGGTCCCATTCTGAAGACTCACCCACC
TGCTGCCCGGGAGATGCTCACGCAGTATCGACTAGGTTGCTACAACGAGTGCAACAAGTGCTGATACACGAATCACGGTAATCTCGATCTGTAGCTCTCA
ATTCATCATGGTTTTGAACTCCATTAAGAAAGATTTGTTTGCTCCATCGCATCATTACTTGTTGGCTCGGAGCTTCTACAGCGGAGGAACCACACAAGCA
AGACTTCGAGTGTGTACTATGCACCCCAGCGGTGTATTTCCATTCATGATCTTTTCAGCGAGCAGTGAACCATCAGAAAATACCATCACAACTCGAGGCC
ATCTTCTTCTTCGTCGGCCACTTCGCTGATGTCCTCGCCTTGCTCAGCTGACCAGAAGAACCCCAGCGCTTCCAGCGTCGATCTCAATAAAGTATGCGAA
TCGCCTCCTTTTCACGACGTTCGTGGCCAATTCCCCGAGATTCAGTCCACGTGACGCTGCTGGCCATAAGTCTTCCCATGGCACCCCGAAGTCGGAGGGG
ATGTCGGCACTCCCAAACGTAAGCGCATACGTCGTCAACGCTGGCATCACTCCGTACTTCCACTTGGCCGCGCTCCACTGAAACCCGATGTGTTCCAGCC
TGTCAGAGTCCCGCGCAACTTGTTGGGGGAAGTCACCTCGGTTTCGAATGTTCCGCGCGATGAAACCCAGGCGAATGTCCCAAGTCGACGGCGGCCACGG
GTCCTCCTCCGGTACGACAAAGAGAGTGGCAATGTTGCAGTCCCCGTAGATACGATGGTACGTCTCCAAAGCCGGCAGAACGGTCTCTCGCCACTTTTGG
TCGTAGCTGCTGAGACAGAAGCCCAAGTTCTTCAGCTCCTCCCTGTCTCGGTCCACGTACTCCGAGTACGCCGAGATGGCTCGAATACGGTTTAGCATCT
TTCCTAGGCGAAATCCTCTCAGGCCTTTTGGCCACTCATTCCCCTCGTCCTGACCTTTGCGGACAACGAAGTTCTGAGGAACGTCACAGTGACCATATCA
TGACGGTTCCGACTTCCCTACATATTCCGACAAGTAGGCAATTGGTCAAAGCCAGTGCAAAATCGGAAATAGTGAAAAATCGGAAATTAGCTATTATGTA
CGGTAAATTAGGACTAGGGGGCCGTTTGACCGATTCTTGTCAGCTTTCATGCGGTGCTCACAGCCGCGAGGAAATCGCCTCTAGAGGCCTGTGGGCCGAG
TAAAACGGCATTTTTTTGCATCTAGGCGCAAAATCGACTCGGAGCAATGTGCTCTCGAGGTGGCAAGTTCATTAATGAGAGCCAGGATCCTGTGGTGGGT
CCACTATTTGGGTTGAATGTCTTTAAACAGTGATATTTACACTTCACAAGAGTGACCCTCTCTTCCAGAGCCACTCGTTTAAAAACCTCAATGAGGTTTT
ATTTAAGCCAATAGAAAAGCGCCAACGCCGACAGAGGCCCCGCGGCTTCAGTCTAGACTTTTTAAGCCGAACCCCCCAGACCGCAAGCCAAGCCGGAGGC
TCCACCCTCGACGACGAAGCTAAATGGATGAGCGCAGGGCTTGCCCTGAGGAGCGGGATCGAAGCCCGCCGTCGCCAATCACGCTTGATGGGAGCCTTTC
AAGGTGTGCAGTGTTTGGGTCCGGGCAAGCGGCGACGAGCGGATGAAGAGCGATGAGCTGAGTGCCCGACGGTCTCTGGGCGATGGTTGGCAGGATGGTC
ATGGCCTTGATCTGCGCGTTCGTAAGCTAACTGTCTTGTATTGGTTCATGAATATGTGTATTTGCCCCGAACTTTGTGCCTTACACGTGTCCGACGACTT
GTAGTATGTTTTGGGGTATAGCCGGCGCTGGGCCGACGATCCTTTCCAGGGCGAGGTGGCTTTGATACGCCACGATGCGACTGTTGAGGGCACCAGACCG
ATGAAGCTTGCGCATCTCGCGCAGCACGCTGCCAGCTCCTTTGGCTCGGGATCCCTGCTCGCTCAAGAACCTAAAGACCGCTGCTTCCGCGCGTTTTCCT
ACTTCGAAGACAAGATCTTTGAAGTCGACAGCATCCTCGCGCAGCACGAATCCGCCGTCAAGAAAGAGCTTCATGTACACAACGCCTAGGCGGTAGTCGG
ACTTCTTCTGGCGGTCGCTCGAGTCCCAGACACGGGGCAGCCTCGTGTACCACTCGAACCACAGCGAGGACAGGTTCGTAGCAGCTTTCTTTCTTCGCTT
TGCGGGTGGCGCTTGCTCTGACGACGCTTGCTCTTCTGATGCTTCTTCAATACGCTTCACAGGCGGCGCTTGCTTTAGGATGATCGTCTCCAGTGCGAGG
AGGCGCGCAGACATGAGCCGATTGCTCTCGATAAGCTCGCTAATGACAGCCAAATGGTGACACCCAGCATGACAGCAGTTGCTCTTTGCTTCCGACTTTT
CGTGTGCTTGTTCAGGACTCGAATCAGCAGACGTATTGATTGCCATGGACCAAGACAGCATGTCAGCGACCGGGATATCAGCCGCCCCCAAGCATTCCTC
GATACGCGCAACGAACAGCGTGTCGGGCGCCAGCGCCTTCACTTGCGGGAAATACTTGATCAGGTACGCCGTCAGCACTCCGATAACCTTGCGACTTACG
TTTAGCTTTGCGTCTGCCAGTCCAATGCAGGAACCGAACAGCAGCTCCTCCAAGCGTGCCAGGCGTTCCTGCGTCCCATGGTCCAGCGCTGCAACGTCCG
CAATGACCGGGGCTTCGTCGGCGCTCCAGCCGCTCAGCACTCGGGCGACTTTTCGGTCTTCGCGGGGGGTGTTGAAGACATAGGCAAAGCCTTTGTTCGT
GCGGGTCATATCCCACGACCCGCGGTCAAAGATCCACCGCGCTGCTAGCCGCTCGTCTCCGTTGGCGTGCTGGGCACCTCCTCGGCGAAAGGAGTGCGAG
GTCAGGTTGCTGGTGGCACCGGCGGGTTCAGCCACCCGCTTCAAAAAGCGGTTGACATACGCTTGGACTCCGTCCTCACCGCGGCCGAGGCTGCTCCTCG
CGGGACTTGAAGCTGTGAGCTGAGCTGGCAGGGAGGCGGTGGCGGCTTGCGACGGGTTGGAGCTGGGCGGACTTGGTGTGGGGAGCAGGGAAGCGGTGCT
GGGCGGCGACAGGGACGCTTCCAAGGCCGCCGCGGTGTCGCTGCTATCCGCGACGCTGACCCGCAGCACCACGAGCAGAGGCGCACCTGCGTCGAGCGAG
GTTCCAGCGGTGGTGGCGAGAGCGGGAAGCTGACTCAGCAGCGACACACAGGGCGCCTCCTGCATCACCAGAGCAACGGCCAGCGTGTGAAGGAGGCAGG
TGAGGAAGTCGTCGCGGTCAGGTACGAGGGTGAGGCCTTGCTCTTCGGCAGTTTTCACACGAAGCATGTGTACGTAGAAAACGTTGTCCGCTGACACTGT
CATGTGCTGCTTGCTGATATAGCAGAGATCCGAGGAGCGCCCAAAACAGTGCCACATGAGGCACGCGAGCGCCGCATCTTCGTAGTCGGTGGCGACAGAC
GCCGTGCTGTAGACATAGCGAATTAGTGACCTTAAATCCGCCTTCGTGCAAGGCGGAGCATTGTTAGTAAATCCCCCATTGTCCCGTTTCAAGCAATGTT
TTTCCAAAGTCTTGCCTTGCTTTAGCAGGTTTAACTCTGTAGGAACCCGAAGATGAGGATGCTCATCGAAAAACCAAAGCTTAACGGCTCTTGCCAGAAC
TGTCACCACGCACACAGGCTTGAATGACATTCATAGACCCATTCTCTGCTTCTAGCATGTACTCAAAAGCACCAATCCCTGTGGTGCGCGCTTTTTGCGT
GTTCGCAGGGATGAGTGCAGAGAGACTCATGCTGATCTTTGTCTGGCGCTTCTGCCGTTTCAAAGTGCCTATGTGTGTATGTGCGGAGGACCACCAGTGT
CTCCACTGTCTAGAGCTCCGGGCCTAAAATAGATTTCTGCCTAGTTGTTGTAATCATGAGCATATTTGAAAAGTACGTACTTGACTGTATTTCACTATGT
GCATATACATATTTGCGTCTTGCTTCCGACAAATATTTGTCAGAAGCTGTCGGAACTAAAACCCTATCCCTGTGTGATTTGATTGGATGAAAATAGTGAA
TAGCGACTGTGTGATTGGTCAGGCCGTCATATATTTCCTGTTCTGTACAA