Description :
From Genome Similarity Track
Location :
Scaffold_817:9848- 11440
Sequence
1592 bases(100 bases per row)
CATCACCTTTCGTCAGCCGAACGCTAAAGCCGATTGAGTTTAATTACGGGGCGGTGGAGAAAGAGATACTCGCACTCCTGCGGGTGTTGGATCTCAATTA
TAACCTGCTGGTGGGAAGATCCATCCGGGTTTGACTCGACATTCCACGCTCGCCTGGTTGTTCCAGTCGGCCGGTCTACAAGGACGGTTGGGCCAATGCG
CAGCTTTTGTTTCACCTTGGACACTGGAGATCGTGAAATGTTCGAAAGGGGAAGACGCGATCCTGGGAGTTTTGGCCGCGAACATCACACCCAGAGCCAA
GATGGACGAAGCACTGACTAGGATCGCTCCTAAGAAAGAACCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAAGTGGATGAATATCTGTATGT
CCTGAGTTTCGATTTATCTGCTCGCGTGCGGCGCGGAGGAGGAGCATACAGCACAATTCTGTGGAAATTGCCCGGATGGGAAGTGGTAAGAGCCAGATCC
ACTTATGCGGAGGGCCTCACCGTCAATGAAGCAGAGTATAACGGGCTCCTTCTGGGTCTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTT
GTGGGGATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAGCGCTGTTACGGCAGAAAGTGATGGTCCACCTGCG
TGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAG
GTGGAGAGAGAGGCCGAGCATCATGATCTCGTCACGCTGAACCGACTAGACGAAGTGGTGGTGGTTGGATCCGTAAAAAGGACAGTCCAGGTAATGGCTG
TCACTAGATCCAGAGGAAGGATTGGATCCAGCCCCCAGATTCTCGATGAAGCGTATGTAAAGAGAGTCCATATTGAACGGATTCTCAAAGCACAAAACGA
AGAAACATGGATATTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATTCTACCGTATTATCGCTACGGATTAT
GCAGTGGATCTGAATGATTTGCTCTTCTATCGCCCCCTACGAAACGAGTCAGCGGGGATCGAGACGGATTGATGAGATTGGTGATGCCGGAAACCTTGCA
ACATGACGTCCTACATCACTATCACGCTAGCTTTGAAGGCGGGCATCAGGGAATCGGTCGGACCTACCAACGGATCCGAGAATGTTTCCACTGGAGGAGA
CTATTCAAGAGTATGCAACGATATGTTAATGCGTGGATTGTGAGACAGGCAAGGGCAGACCCACCACTGGGGGGGGGTCTCCAGGGAATGTCCAAGCGAC
TTAACCGTTCCAAATCATAGCCATAGATCACATTCCCTCGCTACCCAAGTCATTCAAAGGAAACATGGAGTTGTTGATCTGGGTGGATCTGTTTACCGGA
TACGTGATAGCCGAAGCTAGCGCGTCCAGAGCTGCACAAACCATCGCCGAATCGTACGAGGAGTTTGTTTTTCGGAAATTTGGAGCTAGTGA