Description :
From Genome Similarity Track
Location :
Scaffold_21:98458- 101421
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008264Similar to Topbp1: DNA topoisomerase II-binding protein 1 (Mus musculus)
Pytul_DAOMBR144PYU1_G008263Similar to uroc1: Probable urocanate hydratase (Dictyostelium discoideum)

Sequence
2963 bases(100 bases per row)
AGGCTTCAGTGAGCTTCAACATCCCGATCGTGCACATCTCGTGGCTGCATGCGTGTCTGGAGAACGAGACGCTGCTGGACGAGTCCGAGTTCTCGCTGGA
GAAAGTGCTTCGACCGAGTCGCTTGTTCTCACAGCTCCAGGAAGAAATCAACCAAGTGGTGACGGCACTTCCGCAGTTGATGAAACGGTATCATGAGCAG
CACAAGCAAGACGATGACTGGAATCCGCAGGATGATGACGACGATGTTGAGTGGATGGACTTGTTCGACAGCTGCATCTTCCATTTGATCGGGTTCCCGA
GCAACGTCGAAGCGCAGTTGCAGCAGCTCATTCGCACGAGTATGGGCACGATTTACTACGATATGAGCACGGCCCATGTGACCCATGTGCTCGTGAGCCC
GTCGTTGCGAGACGGCCACGCGCTCGCATCGCTCGAGGAGCAGGTGTCGATGGCACATGCCGAAACCCACGTCCACTTTGTATCAGCGAAATGGCTGCTC
GACAGTATCAAGTGCCTTCGCCTTGAACCAGAAGAAATGTACCCCGTTGAGATCGACGCGGACCACGAGATGCCGCCAACAGCTCCATCAGTGCCGTCAA
TGTATGAAACTGCACTTGATGCATCGTATGAACACATTCCCGACGCCATAGAATGTGCAGCAACAATAGCAGCTGCGGCACAAGATGATGGTGCACCACC
AGCCCCGGATGCTCCACAAGATGACGCTGACGACATTCCACAGGGCAACAAGCCGCAGTCGCTGTTCAGTGGGTGCGCATTTTTGTTGCTCTGTCGCGAT
CCAGACGACCGCCTGCTGATCAAACCGCTGATCAAACAGATCCACCACCAGAGCCAGGCGCAAGCGTTCGCGGTGGACTTTCGAGACCTCGCGCACTTGG
ACACGAGTCAGTTTACGTTCCTTACGCACATTGTGATCTGCGATGGCGTCGATGTGGAGCCTGACGTCGCGATGCAGATTGATCAGCAGTTCGCGAGTCT
CAAGGATGTCGACAAGCACGACAACAACGATCAAAAGAAGCGGAAGCGAAGACGCGGCGTGACGTTCGTGTCGGACCTGTGGGTTCACTGCTGCCTCGCA
GCGCAGGTGATGCTCTCGCACCAGGCCCACGAGCTCTTCTCACTCACGGTTCACCAGACGCGGTCGCTGTTCTCGCATCCGCTGCCGCTGCGCTGCTTTA
CCAAAGTGCGCGCCAGCACGTCCGTGTACGTTGGCGTGGATCGAGTCGTAGTCATGGAGCTGCTCAAACTCGCGGGTGCGCAGGCCACGAGCAAGATGAG
TAAGCGCAATTCACACCTGATCTGTCTCAAGCCCATCGGCATGAAGTACGAGAAGGCCAAGGAGTGGGGGCTCAAGATCGTCACGGCGCGCTGGTTGATT
CAGAGCATAATACAGGGCACGCTGCTCGACGAGCAAGCAGATGAGTTCCAAGTCAAAGACGAGGACGACGGGAATGGCGACGCTGATGAAGCTGCAGCGG
ACGTGAATGGGGGTGATCAAGCTGGCGAGTAAGTACGCTGGTGTCTAGACAAATGTACAGAGAAGAGGGTCAAGCGCAACCAAATTGCCATGCTTACATG
CATACACGTATTACACCTACATGGGGTTTCAAGCGACGAGAATGATGCTGATGCTGTGCGGATTTTGACACTCATTTTGCATTTATTTCTTTTCCTTTAC
ATACTGTTAGCAGCTCATCCGAGGATCTCTTCACGATCTTGGAACAAGCTTACGAAAAGTACTTGCCGACGACGTCGCGGATGCTCGCATCATTGGATTC
GTTCGGCAAGGTCACGCGCAGCAACGGATCGGCTTCCATTTCACGCTCGATGGCAAAGCGCGCGTTGTCGTTGCGTGCCCATGCTCTTCGGGCCACGCCG
TTGTTGACGTCCCATCCGAGCATCGAGCCAGCCTTCTGGCCCGCAGCCTTGGAACCATCGAGCACCATGCCGAAACCACCGTTCATGACTTCACCCCAAC
CAACGCCTCCGCCGTTGTGGATCGCAACCCAAGTGGCGCCACGAGCAGCATCGCCAATGACGTTGTGAATCGACATGTCCGCACAGAACTGAGATCCATC
ATACACGTTCGAAGTCTCACGGAAAGGAGAGTCCGTGCCACTCACATCGTGGTGGTCACGGCTCAAGATCACTGGCTGAGAGATCTCGCCCTTCGCAATC
GCGTCGTTGAACGCCTGAGCGATCTTCTGGCGACCTTCACGATCAGCGTACAGGATGCGCGCCTGGGAGCCGACGACGAGCTCGTTCTCTTCGGCCGACT
CGATCCAGCGGATGTTGTCGCGCAATTGCGCAGCGACACGTGGAGGGGCCTTCTCCATGAGCTCCTTCAGCACACGGCCAGCAATTTCATCCGTCTTGCG
CAAATCCGATTCCAAGCCCGACGAGCAGACCCATCGGAATGGACCAAAGCCAAGAGAGAAAATGTCGCCCATGATATCCTGCACGTACGATGGGTACTTG
AACGGACTCGCCGAGTTGTCAGCGTCTTGCAAAATGTTCGCACCGGCACGCTTAGATTCCAGCAGGAACGAGTTGCCGTAATCCCAGAAGCGCATGCCGC
GACTGGTCAAGCGGTTCACAGCGTTCACGTGGCGGCACAGACTCTCTTGCACGAGCTGCTTGAACTTTTCTGGATCCTTGATCATCATGTCTTGAGACTC
TTCAAACGTCAGCTGCACCGGGTAGTAGCCGCCGTTGTATGGGTTGTGCAGCGAAGTTTGATCCGAGCCAAGTTCCACAAGTAACTCTCCCTTTTCGGCT
TCATCAGCGAGTCGTTCCCACAAAGTGACGACATTGCCGTGGTAAGCGATGCTGATTGGTTTCTTCTCCTCTCGTGCGCGGCGGATACGAGCGATACAGG
CATCCAAATCCGCAGCGACTTCGTCAACCCACCCTTGCTCATGGCGTTTCTTCACGGCCGAGG