Description :
From Genome Similarity Track
Location :
Scaffold_74:98441- 99764
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17723hypothetical protein

Sequence
1323 bases(100 bases per row)
GCATTTGACAGCGGGATATTGCGCGACTATTTGTCAGAAGCTAGCCCACACATGATGTTCGCATGGCAGACATGTCCCAAGCAAGCATGTGCAAAATGAT
CTTCCTGCCTTGCAGCACGACAACATCAGAACGCATTTTACCTCATCACGCACAGCTCAAGCCAGTAAAACAGAAGACAATGTTCTCGTACCCCAGATCT
CCACGTGAAAGAGAATGCCCACCGCCTGCTCCAGTGTATTATGCTCCTGCCCCGCCCCCACCGCCCCCAGTTGTGTATGCCGCGCCTCCTCCGCCGGTCA
TGTACGAGGTTCCGACACCTCCACCTGTCGTGTACGAAGTTCCGGTACCCCCGCCAGTTGTCTACGAAGTTCCAGCACCCCCTCCGGTTGTGTACGAAGT
TCCAACCACAGTCATTTACGAAGCACCACCTCGCGACGAGTACTACGAGTGCTCGCCACGTCGTCACCATCATCACCACCGTGGATGGTGATCAGGATCA
ATCGCATTGGTCGCATTAACCATCAATTTTTAAGCATTAGCCACTTTAGATTTAAGAAACAGTCTCCTTGCTGTGTTCTTACGATATCTAAGTGTTCCAG
AATCTGGACCATCTGGAATCCAGAAGAGCCTTATCGTTAGCAAGGAATCTTCCCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN