Description :
From Genome Similarity Track
Location :
Scaffold_12:98413- 105728
Transcript NameFunction/comments
Physo_130606reverse transcriptase
Physo_130607hypothetical protein

Sequence
7315 bases(100 bases per row)
ATCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCAATGAGCGACATGCATAGCACTGGAATTCTGCCAACCAGCCGTTGGCAGCTTCCCAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTT
AAACCAAGCTACGCTTCCTCGTACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATAACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACTGACTACCCAAGTTAGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCGTGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGC
AACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGTTACG
ATGCTGCGTACGCTAACGTCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATACTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCTGTGTCGTCCG
GGACGACACCACGCGCGCAACCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACGCGACACAGC
CATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGCGCAAGAAGTTGGGCGTATGGACGCCGACTC
TCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACGAGCGTTTGAGCCCCCACAAAACGAGTTCCGGTCGAGGGCGGAGTTCC
TCGGCCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAA
GGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTAGAAGCTGCAATTACTCTTGTAATG
CAGGAGGTGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTGGTGAGGACGGGAGGCCCAGAATCCATGGACC
TCTCGAGTGCTGCAACTGCCGGACCCCAGCAGTCGCAGGGAAATAATGTGCGACGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGAAGTGCACAGC
CCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACATAAAACGCTAGACGCTAGTAGGCGCGGGGCGCCCTACTGGTA
ATGCAGTTCCGCGTGTCGACCTTGGACACGCGACATTGAGGACTGCAGCCCCCAGTGAGATTCATTCTCACTGCAAGAACCAAGATAACAAGCCTGACCT
TGTCATCCTGAATGTGAACTCGATGAGAGCAAACGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGTGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCA
AGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCATCGTAAAGACCGAGAAGCGCATGGTACGCGTGC
GCTTCACGTATGAAGATCAAGAGTTTGTCGAGCCCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATCGGGCATGTCGTGGCTTGCACGGCA
TGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTTGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCACTACGCACGCACCGACA
GGTGCGCGACTCCCCACTCGAGACAGCGCTTAATGACGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCACTCAAGAGCAGCTAGCGTCGGCGTTG
CCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACG
CAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCC
GGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCAACCTCCGTAATGGAGGGCTCCGCTAATAACAGGCGTCGAGGTAAGAAT
GGCGTGTCGACTCTGGGTGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCGGCCGGGCTGCACG
ACGAAGCGCCGGGCGACCGAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGTCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGG
ACGAAGTCAAGAGTCATGCGGAGCCGGGATCCGCAGGACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGCCTCGGCCTGGGGCCGAGACGCTACAA
GAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGCCTC
TCGCTAATCCTCTGACGCAAGCGTCGGAGTTGACTTCACTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAAT
ATGCATTCTCTCGGACGCCGAGAAAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCG
AAGACGAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAG
AGATCCCTGCGGATCTTCCGCAGGGCAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACCCGGCAGAGGCCACTGCCGCG
AGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTC
AAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTCATCA
TCGATTCGATGGCCAGGAGCATTATCTACAGCGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCACTCACTCTCACGA
CCGTGAGCCCGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTT
GCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACATCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCAT
CTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCG
TTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTT
GACCACGTACTTGTTCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAG
TGTCAGCAGACCTTCGATGCAGTCAAGCGGGGCTTGACTGAGTCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGTGACGCAT
CCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCGGCTGAGCGCAA
CTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGAC
CACGCGTCGCTGCGGATGGCTGTGAAGTCACCGCACATCTCGCAACGGATAGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACA
AACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAG
CACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTAGGCACACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTCAGCGCCCTCTGGCAAA
GCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACC
GCTTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACGGCGGGGCATCCGGGCCGTGAGAAGACATACCT
TCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTC
GCGCAGGTTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACCGCCAGGGGAACA
CGGGCGTTGTGGTCTTTGTTAACCGCTTCAGCAAGATGGTACATCTTGCTGCAGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGA
CATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCAGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGG
AGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACT
CGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACATGAACGCCAT
CAGGCACCCACGCCTCCCGAGTCTCCTCGGGATGGTGTCTCCTTCCTTAAGTGGGGGAGGATCTCCGACAGCAACGCAGCAGCCGCAGAATGCCGCTGAC
ACTTGCACAGTGTCAGCCGCAACGACACGAAGTAAAGCCACGAACCGCGCGTCTGTGCAGGACACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGC
GGGGCACATACACTGACAAGAAGAAGAAGAAGAAGAAGAAGAACGGGTCTGTGTAGGGCCCAGACACCACGAAGACGAACGCAGAGGCCGGGCCTACTGC
TGGAAACGAGCTGAACGAGTTCGGCTCGGACGTAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCGGTC
GACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAACAAGGATTCATTGGTTTTGCTAGCTACTCAAAACCTGCCTAAAC
ATGCAGTTTCCGACTTCGGGGCTCGTTCCGTGCTTCATCGGGCCGTTCACGGTGTTGGTACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCA
TGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCG
AACCTCTGCTCAAGCGCGTGAACGCGCTGGTCCAAGCGCGCGACACGACCCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGCCCTGAGCGACTTG
AGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCA
ACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGATCGTATTGTGAAC
CATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCATCAAGATGCATGGGAGCCACGGGACGTCCTGC
TGTAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCATCACGCACTGCCGACGCGTAGGTAGTGCGAGCGCTGTAGTCACCTACAGCGCCCGAAGTC
CCACGATCGTCGCGTTCCTCACTTGCCAGGAACTTGGCACGGAGATCTTTGAGACTGGCAGGTACACGAATCGTCGTGTACCCGTTTAGGCCGCGGTCGC
TCAAGCGCACCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAA
CCTCCCGCGCGTCGAGAATGTCTCGAAGCGTTCACGGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGAAATTCTCAACAAAAGCATACCAA
CTTTGACAAAGTGCCTGCCAGTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGTTCGTGAAAGAGTCCGATATAGTAATCGC
GCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCCACATCATCGTCGTGGATGCCGCTGCATACGTACAGCGGGATTTCATTTGGAGGCACGGT
GTTGCCCACACGGTCTGCGACCTCTGACGCAGCCGGCATCCACGGATCGCGCGCTGCCTGAGCAGCACGCGGAGAACTTGAAGACGCCACTTCACGCGGG
AGCTTAAAGTCCCAGCAGTAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAAGGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGA
CCCGGCATGCGGGTC