Description :
From Genome Similarity Track
Location :
scaffold_10:98405- 104288
Transcript NameFunction/comments
g663.t1 conserved hypothetical protein

Sequence
5883 bases(100 bases per row)
GGGGTCACCGGCATCGGCAGCATGAAGACAATCTAGCGTAGTAACTTGGATGCGGTGACAGCATCTTTATTATTGAAGTCATACATGTGTTGCTTGAAAA
CGAGTGTCAACCGCTACACCCCAGCCAGGCCTCGTACTGGACATTGCATTTTGGACCGATGTGTCTATTAATCTGCTGACGACGAAACTCGATAGTGCTC
GGATCCTTAATACACGTAATTGGCATGAACCGATCGCTGTAGCATATTCCGGAACGTGATTCTGATAACGAGCACTCCCGAAAGAGAATTCCACCGCACT
GCATGGCGTTTTGCTCCAGTTCTGCGTCGCGGTCCTCCTCCGATGGCAAATCTGGTCCCTGCGAGTGAGAGGAATCACTGGGGGGCTCTCTAGTTTGGTT
CCTTAAATTGGGAGGTGGTGGAGCTGGGTGAGTCACGCATATTGTCGAGTTAAAAGCTTGGAAAATCTCCTGCGTGCCAATTGTTGCTGTAAGCTCGTCC
GGTAAGCAGGAGCGTTCTTCACTTTCCTCAAATTCACGAAGTCCGCAGGTTGGGCTGGTCAGATCGCAGCCAGTTTGTAAAAATCCGTTGCAGCAAAGGG
GACCAGCGTCCACTACCAGCGTTTTCAGAGATCTACGAGCACTCGAAAGGTCTGGAAACGTTGTGAGGTTTGGTATCATTAGCGCCAGCACGATTTCAAG
ATGTTCCAGCTGTGAGAAGTCTGCAGGTAGCGTATCCATCGAATCCATCCTAGCCAGAGTAATCGACTTAAGGTTCTTAAGGCCCGATACACCCGGGAGT
TGTCGTAGTACCGCGTGAGCGCCCAAGTGAAGGAACGTAAGCTTTGTCATGTTGGCGAAGAGGCCTTGGGGTAACGATACCAGACTACACCGATCCTTGC
CTTGAATATGTAGAAATTCGAGGTTGGTGAACTCAGCAGCCCATCGTGGTAACGTTATCGTGTGTGTGAAAACCAAGGCTCTGAAATAGACAAATTGCAG
TTAGAAATGGAGCACATTGCCACGTAAATATGTGAAATACCTACATATGCTTCATCCGAGTACAGTTTCGCAATGAGTCGGGTAGTATGTGCAGTTGACG
GTTGATAAGCTGTAGAATTTCCAGATCACCCGAGGCTGCGAGGTCAGAAACTACGGAAGTGACATCAGGAGGGTTTCTCCACACAGAAAAATTGGCTGGG
GAGAGATCTGCATCGACTAAAACCCGACACGGGCAGTTCCAGACGGCATCGCCGCTCTCCGACTCGTGAAGTGTAGAGCTTGAGAGCCACCAGCGATGCG
CGTGCATTGTACACGTTGGAAACGAAGCACAAGCTTTCTGCGACCGGTGTACACTGACTGCCACAAACACGACAGTAGCCACAGCGAGGACCACAAAAAC
CGACGCTAGTGGATGTTCTCGGGGGTAGATGCTCCTCTTCGTCTTCAAATGGGAGTTCATTATCACCTTTGGCGGCGTTTGGGCACGCAACAACCTCATT
AGACGGCGTAGACTGATCAGCAACGCGAGATTGTTGCCCATACGAGCGATCCAAACCTCAATTGACAGGAAGCGCAGGCCGTCTAGACTTTTGACAATTT
TGGCAATCTGCTCAGGGTTGGCGTGCACTCGCGCTGCATTTTGGAATGACCAGCGAGGAAAAAGATCAGCCATGAGCGCTTGAGAGGCTCGGTCGAACTC
AAACGTGGCCAAGCAGTAAGTGAGAACTAATACAGGGAAGAGGATTGAGACTAGCAAATCCGAACTACACATTGATGAAGTCAGAACTTTATAGGTGAGC
AGCAGTTCATACCCTCACGTACACTGAATCCACGAAAGCTTCGCCTATTTGAGACGGTGGAATTGGCGACAGCATCAGTCCTGCGACCGCAAATGCATTC
CACACGATCATCAACGTGCAGGAAATGACGAGCGGCAAAGGGAAGCCGGCTTCCAGTATTTGGTGCAGCACGAACTCTTGAAGCATCAAGTCAAGCATCT
TCACACCCACTCGCTGAAAATTCAGCGTTAGTTACTCGAGTTGTAGTGCTTCGAAAGAATACAATTGCAGTACTTACCACGATTTTTCGAGCCTCACTGT
CTTTGATGCACAGGTCCGAGAAAAAACTCCGGACCAGACCAGTTGTTTCGAGTTGGTCGCTTTCACTGTCTGGTAAATCTCCTACAGGGTAGATGGAAGC
TAAAGAACCCGTAGAGCGTGTTTTGCTGTCGCGTCTAAGACGAAGTGGATCCTCTAATTGATCCACCGCTGGGCCGCTTTGAGCTGCAGTTAGAGTCCGT
TGCCGTCCCCAACCTAGAAGTAAAGCACCAATGTAAAAGTACCCCAAAGCCACAAGTAAAAGTCCAGCGATCGTGAGAGCACGAAGTCTTGGGGTTGGCT
CCACAAGCAGCCAGAAAGATCCGTTATCCAGATCCGTCGTCTGCATAATGTAGTTGATCGTCTCATTGGGCGCTACTGTTAATAGCAGCAGCCAGCACGT
CCAACTCACACACATGACCAGTATTAGAAATAGTGCAGCAAAGAATACTCGGGACTGATACCACAGAGCAGGGCCCTGTCTCGTCTTGCTAAGTCGTCTC
CACTTCCGTCGTTGTGAAGGTTCACACGCTTCATTGTCAAGGTGCAGCGCGGTGTCATGCGCACTGCGAACGCTGCTGGCCGTCCTGGATGTCGTACATG
TACTCGATCGATCAGGACGCACACGCCGTCCCACTTGGTGTCGAATCCAGTTCTTTGGAGTTGGCGGCAGCGCTGTCCGGGCCATTAAAACTGCTGTAGG
AGAGTCTTGCGTAGACGACGAAACTAGCAATGACTTGTTAGCACAGAGACACGGTCCACCGGAGTCTACGAAAAGAGAACGGCAGCACATTTCATTATTA
GATTGCCCCGTGGAGCCGTTAGAAGAAGGAACAGCAGTGCATACTAACGTCATGCAACTAAGAACGGCGCACGATATAAATGGAGAAAGGGGTCTTACAG
CAGCGTTTGCTTACGCAGTCGGTTCGACACTTGCAGCAGTCGCCGACACTGGACTGGAGCGATCATCCTGCTGTGCGACCGAGTGTTGGCTCTTGGCCTT
CTCCTTGAGCGCCGATCGGTTCTGCTCGCTACTCACGGACGATCCGGTTTTGTTGGACTTAAGGGGGGTTTGGCTTCTCTTGCTGCTGGACGTTGCGTTA
GTAGCTGCAACTTCATCCGAGCGCACACCATTGTTTTCCTTACCAGTCGTGCTCTGCGGCTTTGTCTTCTTGGCCGATGCAGGGCGAGGCTTACGAGCAA
TAGCAGCCAATTTGGTCTTAGCTGGTGACGCTGTTCGTGGTCCATGGTCCAAATTCTGCGATCCCTTGGGTGCGAAGCTGGACTCCACTGTCAGTGGCGG
CAACGGACCACTATACGGCGTGTAGTTAAAGTGAGGACGTTCCTCCTTGTCCTTTATTGCCGGAGCAGTCCGAGCCGGTACAGACGCACGCTGAGGCTTT
GTCAGCGTACGCTTCGGGTCGATTGGCTTACGGGCGGATAGCGGTGTCGGCTTGGCCCGCGCGTGCTCTTTAGCAGCTGCAGCTGTGCGGTTAGAAGAAG
ACTGCGTCGGTCTCGCAAAGGAAAATTCCCCGGCTTTAGTCGTTGTCTTGGCGCTTCGGTTCGGCTTGGTACCTGGGGTCTTTATCAACGTCGAGGCGCG
CGCCTTCTTGTTCTTCTCATGCTCCGAAATCGAAGGATCAGCCGCGGCGTTACGCGCGTGCAGAGCGTCGAACTTCCTCTTGGTGGCGGATATCGTTTGA
CTTGGCGTCTTCTTGGCCACGGACTGCGCTGGTTTCGCTGGAGTTTCTTGCTTCTGTTTCTCGTCTTCGTCTTCCTTTTTTTGCTCCTGTTTCTCCTCTT
CCTTCGAGTCAAGCTGCGTCTCCTCCTGCAGCGTCTGCTCGTGCATAGCAGCCGGTTGCTCCTCCATCTCAGTGTCTTGCTTGTGCTCCTGCCCCTCGGA
CGGCAGCTCCTTCGGCATAGAGACCATAGCTCGAGGTGTTGTCTAACGATTGCGGAATGCCAAGTTGGCGCTCAAAATTCAAAACATAATGTTGCGCTAG
TGATGTTAAGTTGCTCTTTTGAGTCATGTATCGTTTATGTTCAAGAGACGCGAAGTTTTTGCTGGTCATCGCAGTGCAGCCGCTAGTTTATCTTGCTGCG
TAGAGCTGAGCTTGGATGAGGCACTAGACATTGCTGTGGGTCCTAACGTTCTACGTAGTTGTCGTAATAGCCTCGCATTGCCTTCTTTCACGTCGCTTTT
GGCTTCTTTCAGCAGGTCCAGAGCCAAGGGCAGCACGTGGCGAATCAGGACGTAGTTGCTCTTGTCGTCCAAGCTCCTCGCAGTCAGTTCTGTCAGTGTA
TTGAGAAGAAGTGGAAGTACGCGGGCGTTGGCACTGCGTGCTTGGATCGCAAACTGCTGACATAGCAAGCGGTTGTCTGCGTGGGCGCAAAGCTGCTGCA
CTACGGACTGCGCAAGGGTCGACGTCCGAGGGTTGGCGAGGTTTTTGGTGATCGCAGGCACGAAATTCGGAAGAACCTGTTCCATTCCACTACCAAGTGA
GGGAACAATCGTGTCCATGCGTTCAAGCGCAAGGACATTCACCTTGGCATTGCCATCGTCTAAGCGTTTGATGAGCTGGTCGAACAGATTCAGCATCTGA
CCGCTTTCGCCAAGAGCTGATGCGCAGCCACAGATGAATTCTGTCGTCTCGTTGAGTGCGTCAAAGCGGTCTTTCCAATTGTTACTTCCGAGCTTCGTTT
CCAATCGAAGTAGCTCGTCGTTGTTGATTTTTGATCGAGATCCATTGCTCGTTGTAGGTGGCGAAGTTCGACCAAATAATTGCTTCGTGAGTTTCTTCGT
CCTTGGAGGCGCTACTTCTCGTTTCTTGGGGGCAGAAGGCATTTCTAATACAGTCTCAGGTGTGCTGGAAGGTGTTGAAAGTAGTGGTGGTGAATACCCA
ACTTTCCCACTGAGAAGGGAGTCGACTTTAGCATGTTCTGATGGTGGTAGAAACCTCTTAATCCGCTCGCTTGCCATGCGCTGCTTGTAGTGTAGGTACA
GGACAGATTGCTTTCCAATATCGCGCACGTCGTTGTTGGAATCCCCGAGGCTCCGGCCGACCAGTTGAAGGATCGAGGGCAGGTCTTTACTTGTTTGGAT
ATTGTCAGCCTGGTCCATGATGAGTGCGTGAAGAGCACGCGCTACTTCTCGTCGAATTGGCACAGCCTTGCTATTCACATGAGATCCTAGCGCAATTACT
ACGCGAGATATCGAGCACTTAAGCACCACCGCACGTAACGATGCCGCTGCTGATTCACATACAAACGTGTTGGAGTCTCCAGAACGTTTCAGCAATACAG
GAACAATATTTTCCACCTCCGAGTCCATCACCCGACTGAAGGCAGCACACATCGACTCCAATGCCAAGAGCGCGTTCTTAGAGACTGTCGAGCGCAAATT
GGAGACTTGCTTCATAATTTCAGCCAGAATCGCGTGCACTTTACCTGCATCGAGCAAACTTGTGTGATGCAATGCCAGCCGCCGAACGGTGCTCAACGCG
TCGAAGTTCACTTCCCAGTCGTCACTTCGAAGTTGAGAGAGAACTTTGCTTAAATCCTGCTTCGGATTGACCAAAGGTGCGATCTCATGCGACTCCAAGT
ATCGCGGCTCCTGTTTGCCTGAAGATCGGGGGGCTTCATCGACTGCACCAATACCTTTGATTTTAACTGGCTTCTTCCAGGGCTTCGACATTTCATTCTG
CACAGGTGACGGTAACTTACTAGAGCTGTTAGTAGCTTTCGTATCCTGTTTAGCCTTCGCCTCCAAACGTTTTCGAGTAGCCA