Description :
From Genome Similarity Track
Location :
scaffold_36:98402- 99796
Transcript NameFunction/comments
g1672.t1 conserved hypothetical protein

Sequence
1394 bases(100 bases per row)
AAAGCATCCTTGTCGCTGGCGTTAAACTTTTTGTTCTTGTTCGCCTTCTTCTTAGGGGAAGAGGCCTTGGCAGGCTCAGCGGCCTCAACAGCAGCCGCAG
CGGGCTTCTCGGCCTTGGCACGCGACGTCTGCTCGTTAAACCAGACCTTCTTCTCCTTCACGGCAGCCAGCGACTCTGAGACAGCAGTTGCAGAGGCGGG
AGGCAGCAGGCCAATGGTGCTGAAGGCTTCCATCTGAGCAAGCGGCAGGACCAGCTTCGTGGGCTTCTTCGCCTTCTTGCCCTGACGGCCCTTCTTGCCC
TTCTTACCACCGCCAAGCATCATGAAGTCCTCCTCTTTGCGCTGCAGGGGCTTCATGCCGTCAAGCTCAACGGGAGCGGCAGCAGTCTCGGCCTTCTCGT
CCTGCACCTCCTTAAGTTCCTTGGCGTAGGTCTTCTCAAGGAAGGTAACGAGAGCATCGCAGAGGTCCATCTCGTCCTGGTACGGATGGATCTTGGCCAT
CTCCTTTTCGTAGTCAGCAAGCTTAGCCTCATACTCGGCCTTGCGGGATTCCTCCTCCTTCTGGCGCTCGAGCTCCTTCTTCTTGCGGACAAGACGGATG
TTGTTGTAGTACTTGTCGTTGGCCTCCTTAAACTCCTTACGAAGAGCCTTGAGCGCCGTGAACTTCTCGTCCAGCTGCTCCTTGATCTCCTTGCGCTCCT
TAGCGAGCACAGGGAACTTGTCCTTCTTGTTTTCCTCCTCGTTGAGACGGTAGAGCTCGTCAAGTTCCTTCTTCTGCTCGTTGAGCTTCTCCTGAACAGC
GTCGATCTCCTCGTTCTTCTTAGCCTGCAGGGCACGAGTCTCCTTAATGCTCTCGTTCTGCTTCTCCACAACTCCCTGGTCTCCGGAGAAGGCAGAGATC
TGCAGCTTCTGGGCCTGCAGCTGCTCGATCTCCTTGATCACGCGCTTCTCCTCATTCAATGACATAGAGCTGGTCTCCTGCTTGTACTTGAGCTGGGAAA
TAGCATCGTCGTACTCGCCTTCCGAGTTGAACTTGAGGTTAGCACGGGCGCTACGCTGGGACTTGATGGTCGAATCCTTCTCGTCGCGGGTCTGACGCAG
ACGAGCCGTGATCTGGTTGCGCTGCTGGATGAGGTTCTCCTTCTCGTTGCGCAGGTTCGCGAACTTGGCCTTGGCCTCCTGGATGGGGCCGCCGAAGCCG
CCGCGGCTCGTCTTAAGTGCGTCCATCTCGGCGCGAATCACGTTCGTGCGCGCCTGCAGCTTCTTGATGGCGGCATCCAGCACGTTGATCTTGGCGTCGT
GCTCGGTCTTGTCGGGCTTGGGGAGACGCTCGATCACGTCTGGGATCTCCATGTCCTCCACGACGGCAGCAACAACGGGCTCCTCGCTGCTCAT