Description :
From Genome Similarity Track
Location :
Scaffold_13:9840- 12186
Sequence
2346 bases(100 bases per row)
gaaaggatggctctcgagcggaagctaagagaatctagcaatgccattaaaaagctgcaggaggacgccgttgccgcagcgcaagcgcattcagaagcaa
tggaatcgcaaaatctccaagcaatggagaaagaacaagaattggtgatgaactttcaagcgaaacttcaagtgaaagacaagcagctcttaaagcttca
aactgagtttgatgatcatcgggcaaagacagaagaagccaatcgtctccatcaattgatggtggaggagaaggatgccgcactcgaatgtcttcaacgc
cagctcgacgaccaaaagcaggcattcaggctcgaactggaaagtgtgcagcacaagctgtccgaggctctcactgacgtttcaaagctttccgatcaaa
agggtcgagtcgaaacagagcatgcaagtgtagtgaaggaaatccagcgtcttcaggatgacatgaagcatcttctatccgagaaagacactacaatcca
gagcctgtcaaagcgtgtggaacagttaactgtgcaaacgaccgacctggatactcacaacaccgagctgcaggaggagtgcaagaagcagcaaacattg
ctgtctgaatcagaagaaaccataaaaaccttcgcgcaagaagttgagatgctgcagcaccaagttgcagcacaatcaagtgagatttctgagcttcata
agggccttgctgcagctcaagaggccaatcagcaagctgaaatgactattacccagaagtctgatgagcttatcgccagtggagcaataattaacgagct
ggagcaggccctcagcgatagtaagatcactctggagtctttgacaagtaaacttgagaaggctgaggatgatattcgagatgctgaaaccacctcttca
cgccaacaagaagagatcaggatgcacaagggtatccagaatacactgcgtgatgagatgaagaatctagaacttcatcgactcgagttgaccgagtctc
taaaaactgaggaagattccaagcagtgtgtagagcaagagtttactgaagcgcgaacagcatggttggaagagaagaacaaactgaagggattgatttc
agctctcgagaagcgtaccgaggacttgattctcgacggagagactgtctcggccagggaacacaaactgaagctagaaaacgaagccctcgagatatcg
tttggagagcaggcgaagattttacaagagctcaagaaccgcgtcattgagaaggaggatacgattcgtgcgttggagttcagctctaccggcctcgagc
ggcaagtggcagagcaacaaaacactatggcaaagcaggaagcagagatcgccaaaatggctacttctctctcagagagcaacgacaccattgctgtgtt
gaaggagcgtgcagacagcaatgaatctgcgtggggtcagaaaatcctcgagtataaagctgaattggaggcagcacgcggccgtgtgcaggcatttgag
cagttggacgaggagaagactgcagcgttcaagaacgctaaaaaggtgctagtggcagagaaggattcccttgaacagaagctcgaggaaaacgaagaga
tcttagcacagcaaactgcgcaaatgatgatggagatcaaacagcttacatcgaccgtcgaagagaaggatgcgcagctacagcttgccaacaaatctct
tgctgatttgaaggacgggttggtgcgcgcagccaaggaggatgccaacgcgaaggtgaaagagttgcaagccacaatagaagaactggaaagcaagcac
aagttacttatggcggagaacgaagatcttaaggagaaggcaacagctgagttgaaggagaaggaagaggagctcaatcgccgtcgtagcgaacttgacg
acgcggaagagcacaacaaatctgttcagaaggcattggaggcacagcaggcagcggctgagagtgctctgaaagaagccaaggcaaaggcgatctcaca
agatgagcttggacaggcgaaacggaggttccttacggagaaggtgaagctccaacgggagatccaaaccttaaccaagaaggtcgaaatgatttcgaaa
gaaaacgagaagctcgtcggccatcacaacagccgacagaagattcagcaccatgtcaaggtgaaggaggagaacaatcgtctactggaccaggtgcggc
agctaacggacgaaaggatcaaaatgcagcgatcgctagagaagctgcggacggtactcaaggagaaggagaacattggtgtggaatctgctagcaatac
cccatcgtctgtatcgcctgcttctagcacttcttcaaaatcgctt