Description :
From Genome Similarity Track
Location :
Scaffold_542:9838- 15478
Transcript NameFunction/comments
g15437.t1hypothetical protein
g15438.t1hypothetical protein
g15439.t1hypothetical protein

Sequence
5640 bases(100 bases per row)
TCATAAGCGTCCACGAGGTCGCCGCAGTCCTCCGAGAGGCGGCTTCCAGACTCCCACGTGTTTTGATCCTCTGGATAACCGCGCCACTTCACCAGATACT
GGTAGTGACCGATACGCCCGCGGCGCTTCAGTATCCTCTCGACATGATAGTAGAGAGCGCCCTCATTACCAATCAGTGGGGGCGGGGGACGCCACGGACG
TGTCGACGGACCAGGACGCCTCGCGTCACTCGTCGACGTCGTACACCTCGGCGAAAGACGTCTCGTCGGCCCGGGGGAGCCTCCTGACTGCTGTGGAGGG
CTGCCAGAGGCTGCTGGAGATGCAACGGACGGATCTTGTGTCCCTACGCGGTCGCGTGCATCTTGTCGAGTCGACTGTTGAGTCAAGACGGGACGTCCCT
CACGATTTAGGTCGTCTCGAGCGCGGAGCGCATGATCTGCAACAGCGGGTTGATGGCCTCGAGCAGGAGCTTCGTCAGGTCGCCCACCGCTGCTCGGAGA
GCGACCGAGCCCTTCAGGAGGACCGCGGTGCCCTTCGGGATCATCTTCACTGGATCCGACAGCTCTATGCCCGCGTGGGCGCACTGGAGGATCAGACCCC
TCAGAGGGCCGCTGCTCCGCCGGCTGTTCCAGCCCCACCCCAAGCTGACTTGATGCAGATGATGGCGAGCGTCCTTCGGCAGTATTCGAACTCGTCGGAC
TCTCAGAGTCGTCTGCCTCAGCCGGGCGATAAGGCTTGAGCAAGCCCACGTAGAACGTTGGATGCGTGGCCATGGCCGATGGCAGGTCCAGCGTGTACGC
GTTGCCGTGGACCCCAATGACCGTGAACGGCCCCACGAATCGTGGCCGAAGCTTGGTGCTGCCCACCGCAGTGACTGCCTGGATAGGAAGATTCTTAGCG
TTTAAGAGGACCTGGTCCCCAAGTTTAAACACGTGCGTGTTCTTACGCCCTTGCCTGTCACTGTGTTCCTTTTGCGTGTCTTGAGCAGCCGCCATAGCGT
CCCGGACGCGCTGTCGTACTGCTTCACTTGTCTCGATGAACGTGAGGAGGTTCCGTTTGACGGACGAACGGAGGCCTTGGAGGCCACGCGAATCTTCGGC
GATAGCCTCTCCCCCACCCAAACTCGAAGCCGGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACGTAAAATGGGGTGAAACCCGTCGAC
GAATGCACAGCATTATTCAGCGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGGTCTTCAGTGCAGATGCTGCGCAGTACGTCTTCCAACA
CTCGGTTCACGCGCTCCGTCTGACCATCGGTCTGTGGATGGTCCGCTGTGGACATGTCCAATCTCGTACCGAGAAGACGGAACAAGTGTGTCCAAAAGTG
TGACACAAAGCGCGGATCTCGATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACATTATCGACGAAGAGCTGTGCCGCTTGCGGCGCCGTC
ACGCTCTTCTTCACCGCGACAAGCCGCACCATCTTGCTCAGTCGGCAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAGA
TGAAATCCATGCTCACCGAGCGCCAACAGTCAGCCGGCACCGGCAAGCTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGACACGTCTC
ACACGTCTGCACGTACGTGCGCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACAGACGTATACGTCTTCTCTCGGCCAAGATGGCCGCTG
AGCGGCGTGTCGTGTGCCTCGTAGAGGACTCGATGACGTAAGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCTACCTGATAGTAGA
GGAGACCGTCCGCTAGTGAGTAGCGGTGCAACCGTGAGCGCTGCCGAGCTGTGAGTTTCACAGCCTTTTCAGGCACCTTCAGTGAAGTTACGAGATCGGC
GAGATCGTCATCCTCTGCGTACGCCTCGCGTAGCAGCTCATAGAGTGGGGACTCGAGATACGCAACGTGCGCCAGCTCATAGTCCGGGCGCCGGGACAAC
GCGTCCGCGAGGACGTTCTGCTTCCCTGGTTTGTACTCCACCGTGAAGTTATACTCCGCAAAGAAGGAGAGCCACCTCGCCATACGCTGAGAGAGGTGGG
GCGACGACGTCGCTGTCCGCAAAGACGCATGATCTGTGTAGATCACGAAGGGTTCGCTGCCAAGCAGGTGTACCCGAAACTTTACGAGCGCGTACTTCAT
CGCCAGAAGCTCCTTGTCATGGACAGGGTAGTTCTTTTCAGCCGCCTTGAGTTGGCGCGACTGGAAAGATACTACCCGTTCTCTGCCATCGGCATCGACC
TGCAGAAGGGCACAGCCTATGGCGAAGTCGGATGCGTCGCATACCACACTGAAGGGACGATCATCGTCGGGCAAAGCCAAAATCGGAGCGCTCTGCAGGC
TGCTTTTGATTGCCTCGAAAGCCTGCTGGGCTTCATCGTTCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTA
GTTGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAGCCACTTGCGCAAGTCCTTCTGGGATACTGGCACTGGCCATTGTGCGATCGCGCATATCTTC
TCAGGGTCCGCACGGACACCATCCTTGCCAAGGAAACATCCCAAGAAGGGAATCTCCTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGAT
TCTCGCGCATGCACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTGTCTCCTGAGGCACGACTGTGCACGAAGATATCATCAAA
GTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAATCGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCAT
TCCCACAGCATCCCGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTGATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGA
AGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCCGGGATGGTTGCTGCATTCAACTTGTTGAACGCATGTAC
CATACGCCACTTCCCATTGGGTTTACGCACGCAAAACGTCGGAGACGAGTGCGGCGACTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAG
AATGCGTCGATCACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGCGTGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTC
GATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACCACATCCGAGAACTCCTTCAAAAGGGGGTAGTACGGATCCGACGGGTCTTTCAAAATGGCCGC
GCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCTTCCAACACCTCGGGGTCCATGACCGAGGAGGTGTTGAGCTCGATCGAATCGAATTCGCGTCGG
ATCAGGACCATCTCCTCGAGCACGCCCGCCTTCAGAGAGTCGAGAAACTCGACATACGAGAGCTCTTCGAGTTCCAGTAGCTCTGCTACCGCGGGCAGAA
CAGCTAACTTCCCGCCGTCCTTGTATTCGCCCGTGAGCATGTCCAATACCGTTGGTCCGACCACCCTCTCGGAGGGGTCTGCAATGCGGCGTCCTACGCC
TGGACGTAGTCCCGCTGTAGTTGTGCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGCGGGAGACCCCGCTCGACCA
CTCTCGGTTGCGCGAGCCCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCCGCTCGACCACTCTCGG
TTGCGCGAGCCCCAGCTCTAGCGTCTTCTCTTGCGTGAGCTGCCGCAGCTCGGACGCCTTGTATGCCGCCCGCCCCGTGGGCAAAGGCGACGTTCTCGTT
CTTGAGAGTTCCATGAGCCTCATCCTGAGGAGCACACAAAAATCCCATAGCTTCTCCCACACCCACCGAAGGCACATAAGCTCTCGAGGATGTAGAACTC
GCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTGCCGTTCGCCGCGTGGCACACGATGTTCGTGCACAAACCCGTCTCGGG
AAGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCTAGGGGTTTGTGACTAGCACCGATGGTGCGACTTCGCCAATCAATCCATGGCTCATGTTTAGT
AAGCCAAGGCATGCCTAGGATAAGATCGTATCGATCATCCATGTCGAGGACAATGAACGGTTCGACCGAATTGAAGTCGTCAAACTTGACGTTTAGAGAT
AGTAGAACCTTCCGTGTAGACACGATGGATCCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTAGCATACAATGCAC
TGTTCCTAGCCACACTGGCCTTCGTCGCGAAGTTGTAGGACGCTCCCGAATCAATCAGTACCTTCAACGGCTCGTCATATCCCTTAACGCTGGCTGTGAC
AACCAGAGGTTAGAGCCACGGAGAGACACAGAAGTGTCGTCCCTGGGGCTTGCTCCCCAGGAGGTGGAGGTGGCAGGGCTACCGACCTCGAGGAGGAGCG
ATGTCTCCCAGCAGGGCGTCCCGCACCTAATGGGAGTCGCCGTTTTCCGACACCGCAGACTCGATCAACTTGAGTGACGGAGCGGCCTTGCCGCGACCCG
TCTTCCGCGGATTCGTTGGGCAGTTCCGACGGAAATGACCAAGCTGGTTACAGCCAAAACAGCGACCAATCGTGCGTTGATTGCGCTGGGGACGAGCCGA
CTCGGCCGACGAGATCTCCATAGGAGTGGGATCTTCCGTCGCCTCTGCGCGACCCGCGTAACCCTGCGCCGAGCGCACGCAATGATCTTCCAGCATGGCG
ATGTGCACGACATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGGCCCGGACGGACGCCATCCATGAAGACCGTCACCTTAACGT
CCTCAGAGAGGGGAGCACCTGCCATGGCAGCTTCGAGATTCTGCAGCTCCATGACATAGTCTTGAAGCGTGCGCTTTCCTTGCTTGCACCGCAAAAAGAG
CGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAAATACCCCGGAGACAAAGTCTCT
CGTGCCATCGCCCATGCGCGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCGCTTGACTCGTAGATCTGCCCAGCGCTCAGCGCTATCT
CAATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTGCCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCCTTGCCGTGCGGCGTA
TGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGC