Description :
From Genome Similarity Track
Location :
Scaffold_718:9838- 14033
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_718-fgenesh-gene-0.4Appr-1-p processing domain protein
Pytve_DAOMBR484maker-pve_contig_718-snap-gene-0.8Serine protease family S28
Pytve_DAOMBR484maker-pve_contig_718-fgenesh-gene-0.5Drug/Metabolite Transporter (DMT) Superfamily

Sequence
4195 bases(100 bases per row)
ACGCAGCATAATGTCACGCTTTGTCTGCTCGAATTGAGTGAAGCCCTCGTCTTCAAAGCACACGAACGCCACCTTGGTGCGCCAATTGCGCTTGGCTCGC
ATCATGTCACGTACGGCGGCGAGAGCAATAGGAGCAGCGCGGTCGTACGGGAACCCCATGAGCCCCGTCGAGATGGACGCGACCGCGGCGCACGTGACGT
TGCTGTTGTGCACTGCAGTCAGGGCTTCCACGTACGTCTTGTACAACGTTCGGTCAGCTTCAGTCGTTCGCGTCGCGTAGGGTCCAGCGCAGTGCACAAG
CAGCCGCATGCCGCTGTCGTATCCCGCGGTAGCCATGACGGAGCCGGGAGTGACATAGTCTGAGAATCGCAGATGAACGACCTCGCGATCCAGTGACGGC
CCTGCGCGCTCGTGCACGCGAGCGGCAACGCCAACGTGTGGGTTCATGAACGAATGCGACGTCGGGAATACCAGGCAGTCAATCGCGACGTCCCCAACGT
GCGTGATAGTGCCGATATCCCCCTTCACGACCTCGACAAGTCCGCCGAAGCCCTCCAGTTGCCAGCGGAGGCTCACGTAATCCTCGAGCGCGCGGCAGCC
CAGCGAAGTCTCATGCGGGTTCAAAGCCCCGAGATTTTTGGTGGCCGACCAGTCGACAGGACAATGCTGCGTCATGAAGCGCGTCCACTGCGCCTCGTCC
GCGAGAACCTCCCTCGCCGTACGGCAGACTTGGAAAGCACGGCAGAGTGCAGCGATCGACCGGGTGGGCAGGAAGCTGAGCAACTCGCCGAACAGCAGCG
GCTGCAGGAGTATCACGGACTGCAGCGTCGGTGTCTCTTGGCGCTGCTGGCGACTCGACGAGCGCTTCACATCCGTCGTGCGCGGTAGCTTCTTGCTGGG
CGATGGTTGTTGCATTGGTCAGCGGCTGTCTCGGTACGACTTGGACGTGGCAGTTGGAACTGCGTGGCCGATTGTGTTGCTGGGTCAAAATCCGTAATGA
CTCAAGTGCAACAATGGGAACAAGGTATCCAATTGTCAATTCAGTAATTTTGGGATACACTGGTGAAACGTTGAAGTCCAAACGTTTCAGTCGATTTGCA
GAACTACACGCAGTTCCAGTAAATAATTACGGACAGCTGACATTGAATCTGGGTTCCCAAGTCAGAGATCCCCCCGCCATATTTGATTCGCGACCATGGC
ATGGTGCACTCGAATCGTCATCAGCCTCGCGCTCTCGCTTCTCCTTGGCACAAGCGCTCGGGCGGCGGGTTTGCCGCCGACCCGAGCGCGTGACGGTCGC
CTCTGGCAGCTGATCGAGGCGGAGACTGCGCAGTTGTACGAGGCTCCGGCGGCGCAACAGTGGTTCGAACAGCGCGTCGACCACTTTGACTCGTCCACCA
ACTCCACCTTCCAGCAGCGGTACTATGAGGTCGACAGCTTCTGGCGCGCGCCAGACGGACCTGTGATCCTCTCCATCGGCGGCGAAGGCTCGCTGGACCG
AGCGCCGCAGGGGTTCATCCAACTTCTCGCCCAGCGGTTCGGCGCCAAGGTAACATCAACAGCTCAGTCGATGGCATTTGATCTGCTCAATGTGTAATGC
TGTGGCTCGGTGCAGATCTTGGCGCTGGAGCACCGGTATTACGGACAAAGCATCCCGAACAAGAGCCTCTCGACGGACAACTATCGCTTCCTCACAGTAC
AGCAGGCGCTCGCGGACCTCGCGCACTTTCGTGAGTGGTACCAGCGCGGCTCCATGCCTGCCGGTCAAGACACCAAGTGGCTCGCCATCGGCGGATCGTA
CCCTGGAGCCTTGTCCGCCTGGTTCCGTGTCGCCTACCCGAACGTCACGACTGCGGCGCTGTCTTCGTCCGGCGTCGTGCTCCCCGTGCTATCGTTCCAC
GAGTTCGACGAGCAGGTCGCCACTGCAGCCGGCGAGCGGTGTTCGGACGTATTACAGCAAACAACGGCGGCGTTCGAGCACGAGCTTCAACATGGCAATG
GATCGGCCGTGAAGGCGCTGTTTGGCTCAAGAGCAGACATGTGGGAACCTGATTTCTTCTATATGCTGGCTGATTCCGCGGCCATGGCCGTCCAGTACGG
CCACAAGGACGTGCTGTGCAACACCATGGTGGGTGCGGCCGACCGCGGCGCGTCGCTGATTGACACGTTCGCGCGCTTCACAATCGACATGTACGGCGCT
GAGTTTGGCAACAAGTGCTTCTACGACACAGCGTGCTTGGCGAACGACACCTCACGCTGGGTTGGCGAGGGCGACGACAGGTCCTGGCGGTGGCAAAAGT
GCGCGCAGCTCGCATACTTCCAGGTCGCTCCCGACACCGGCAGCTTGCGTTCGAGCGTCGTCGACTTGGCTTACCACAAAGAGCAGTGCCGCGCAATCTT
TGGCGACGTCGTCAACCCCTTGCGAGGTGTGGAAGAAGTGAAGAAGCTGTACGGCGGCGACCACCCGCCGGGCCACAACATCTTCTTCTCGAATGGTGCC
GATGATCCGTGGCAGCGCGCGTCCGTCGTCAAGACTCTTGGAGACGATGAGGTCGCCAACCTCGCCGAGTGCAACCTGTGCGGCCACTGCGGCGATCTCG
GCGGCAACCCGAATGTGCCGGAGCCGCTGAAGAAGCAGCGTGAGGAGATCATCACGTACCTGTCTAGGTGGATGGGGATTTCGAGTGAGGTGCTCGATGG
CGACGTTGTCTCCGCCGCTATCGTCGTCCCCGACGGCCACCGGTCGTCGCCGCTTGTGCTCGTACCCATCGTGCTAGCGTTCACTGTGCTGGTCATGGTG
ATCCACGCCGACATTGTCGTGCGAGATGCTCCCGCTCGGCGTTTCCCCTACGATCGCCTCGCCACCCACGAAGTATAAAGCATCGTCTTGGACACGTAGG
GCAACATGCATTTTCGTTCACTCTCGTGCCCAGTAAATACCTCGCTTGCAGTGTGCGTTTTGTGTCTCCCAACCTTTCTCTCTCTCTCGCACGCGCTCTC
TCCTTATGTATAGCTGCAAGCGCCAATGACTTGCGCAACCGTCTCTAAAACATGCAACGTCCCAACTGCCTACGATGCATTGGGATCCTACTCGCTCTTC
ATTTCAGCTTAGTTGACGGCCTGAGCGGGAGGCGGCGGCCGCACGGGAACCGCCGACTGGTTCATCTCCTTGGTCGAGATGTAGGCGTAGGCAACGCCGC
CGAGCGTGACGATGGCGATACCGATGGATTTCTGCGTCGTGAAGACGTCGTTGTTGATGACGATAGCCATGACGATGACCACGATCTGCTTCATGTTGCC
GCACACGCAGAGCGTGACGGGCGACGTGACCTTGTTGGCGTAGAAGCTTGTGATGTTGAGCAGGAAGCTGATAGCGCCAGTGACGAGGTACCAGAAGCTC
GCGGCCGGCACGAGGTCCAAGTTGTTCACGAGCGTCGTGTACTCGCCGCTGAGGAAGATGGTGAAGAAACACCAGAGCGCCGAGAGCGGCGCCTGGTGCA
GGATCAGGTCCACAGGGTGAAGCTTCATGTCGCCACTCAGGAACTGGTCCATCACACACACACATGTTGTCAGTGGATGATCACAACCAGAGTCACACGT
GCTTCATGGACTACATACCTTGTTGGACAGCACGGCCTTGAGACCGGCAAAGATGACGGCGACGACCGTGATAAAGAAACCAAAGACCGTGCACGAGTTG
TCGCCCGTGCAGGCGAGGTAGACTCCGTAGGCGACCGGGATGAGCGACAGCTTGCGCTCGGTCGAGTACGACTTGCCAAGGATGAGCATGCTGAGACCGA
CGACGACGCCAGGGACAAGCGCGCGCATGACCTGGTTGAACGAGATCGAGACGAGTCCCAAGCTCCAGTTGCCCGTGATGATGTTGCTCACAAAGATGAA
CGAGAAGTACACCATGAGCGACTTCTGGCCGGGCTTCAGCGGCTTGCGCTCGACGCCGCGGTACACGTGGATGTACAGGAAGGCGCCGAGCGAGTTGCAC
ACCATGTGCACGAACGTGAGCGTCACGGGGAGCCGCAGCGTGCCCAACGCCTTCTTGTTCCAGAACGTCACGCCGATGTTCTGCACGAACCACATGCTGA
GCCAGAACGTCACGGTGGACGTCGCCACGTACATCGTCTTGGCCGTAACGTCGCCCTTGGCCTTCTTCGACTTGGCCTCGCCCGCCTCCAGGTCG