Description :
From Genome Similarity Track
Location :
Scaffold_8:98379- 100037
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03130AlNc14C85G5459
Sappa_CBS223.65SPRG_03131AP-4 complex subunit mu-1, putative

Sequence
1658 bases(100 bases per row)
AAGCGCACAACCTCTGCGACGAACACCGTGCCAAGCAAAACCAAAACCAGCGCAAAATGGACTCCAAGATGCGCCAGAAGCGCCACTACTCGCCGTACGA
GTCGCCACAGAGCGCCCACGGCTACGACGAACCGCTGCCCTACCCGCCGTCGTCCATGCCAAGCCCATACCCCGCGTATCCGACCATGATGTACCCGCCG
GCGTACAATGGCTTCTACGAGAGCCGCCCGGCGTACGGCCACCTGCACCACGCGCCGATGCCAGACGTCGGCGACCAGATCACGGTGCCCACGCCGTCGT
ACCTCAAGGGCGAAGCACGAGAAGCGTTCCGGTCCCGCGTGCTGCAGAAGCTCGTCAACATCATTTCGGAAGAGGTGACGGCGATTCCGCCGCCGCCCAT
GTACAGCGCGCATACCACCAGCGTCTACGAGGACGACCGCCTCCCGCCCCAGCGCCTGCCCTCGCTTGCGTCCCGCATCTCGCGGCACGGCGTCCCATCG
CCCGAGTCCAAGCAGTGAATGTGCCCCCGGGTTTTAATTTATTTTGTTTTGTCGCGAAGCGCCGTGGCAGTACCTGCATTCGTGCGTGGACGCCATTAGA
GGACGAGGTTCGTCGTCATCGTCGTCGGCGCCACCCACAGTGGCAGCTTAGAATCATTACCTGGCGTCGCGATCGCGTGGTGTCACGGTGTACCCAGCGT
GGGATCGTTGCCGTAAGTTCAACATGGCGGCCGCGATGACGCTCGAAGAGCGTCCAAGAGCAAGCTACTGGCGGCCACATACGTGGCGCTGTCGCCACCC
ACGGACAGCTACCATCGCCCACAGGCGGGAGAGCTAGGCGGGAGCACCCAAAGACGCTGAATGCTACAGTACTCGAGCAGCTCCCACCGCCGCCGCTCCC
CTTCCGGTGGATGTACTACATACATCCTGGCTCGCCTGTCTTGATGCTTGCACATAGTATACTGTCGAGCAATGCGACCTGCGTCCTTGCATCTTGCTGC
GGGGCCATGGCGGCGCTTCCAAAGCATACGTGGCTCGCTCCATGACGTGGCAGAACCTCTATCTTTTAATGCCATATCTCGAAGCATTCGTAGCGGCAGG
TTTTTGCGCAGTGTGCAACAATTCCTGCGGCGCCGGCAGCATGTCCATCTCGCAGTTCTACATCTTGAGCAGCCGCGGGGACACGGTGCTCGCCAACGAC
TTCCGCGGGGACGTGGCCAGCGACAGCGCCGAGATCTTCTTCCGCAAGGTCAAGTTCTGGGACAAGGGCGATGCGCCGCCGGCCTTCTACGTCGACGGCG
TCAACTACCTGTACGTCAAGAAGAATGGCCTCTACTTTGTGGCCACGACGCGCTTCAACGTGTCGCCAGCCTACATCCTCGAGCTCCTCACGCGCCTCTG
CCGCGTCTTCAAGGACTACTGCGGCGTGCTCTCGGAAGAGACACTGCGCAAGAACTTCATCTTGTGCTACGAGCTTTTGGACGAGACGCTCGACTTTGGC
TACGCGCAAGACACGAGCACGGAGGGCCTTAAAGTGCACGTGCACAACGAAGCGATCCTCGTCGGCGACGCGGCGCTGGCCAAGGCCAAGCCGAGCACGC
TCCTCGGACGGCCGTCCAACATCAAGGCGGCCAATGCCGTGCGCAAGCCCGTGGCGAC