Description :
From Genome Similarity Track
Location :
scaffold_532:9837- 16564
Transcript NameFunction/comments
Pl_104048hypothetical protein PHYSODRAFT_545950
Pl_104049hypothetical protein PHYSODRAFT_254379

Sequence
6727 bases(100 bases per row)
GCCGTGCACAGAAGCTGTGGCATCTTCAGACACTCTTCGAAGTAGTGCTGCTGGTTCATATCAATAGTCTGAACGAACTCACCACGCGTGAACGGGGTAG
CGTTGTTCTGGTTTTCAGGCTTACCCTCGCCAAGAATCGGGTCACCGGGAAGCGAGTATCGGTACACTTCAACAATCTCATCGGCTTCACTCTTAATCAA
CACAGTGTCGAACGACTTCTCACCATTCTCATGCTCAACTGTGTCGACATAAGCCACACGTAGGTTCGGGTACTCGCGCAGGAGGTAATCAATGTCATCG
GCCTGAGCCTTACCCTCCATGCGGTGCTTCCCGTACACCTGACAAGCGCAAATGTACGAGAATTTCAAGCGCACCATATCCTGCAGCTGGTTTTGCTTCT
GCTCGGCACTCTTGCCAGAGCTGGAGCCAATTTCTAGCCAGTGTAGAATCTTTATCGCATCCTCGTACATCATCATACCCTGAACCGTACGAGCCAGAGT
CTGACCACGGTACGACGCCCACAAGCGAATCTCTTCAGGGTGGTTCTTCTGAGCCTCCTCTGCGGAGCTCACGTCCACACGCTCCAAGAAGTTGTCCCAT
TCCTCCTGGTGAATTTTCGTCAGGTACTTCAAAATCGTTAGGTTCTTGCCATCTTCCTCGACCTGCTGGAAGATCGGGTGGTTCACAAGAGGGTCGTTTA
GGTCCTTAAGCGAGAACAGTACCGTCTCGGCGTAGAACGGCGTCACAACCGAAAAACTGCGCATTTCCTTGATGGAACGCAGCTGAGGGATGTCCATTAC
AAGCGATTTCATGAAGAAACCAAGACGACGCTGAGCCTCAGTTGTACGGGGCATAGCCTCCGAACGGTCCAGCGAAAGTAGCAGGCAAGCACGCGTGGCA
GCACCCATAGCTGTGTCACTGCAGAACAGGTTGACAAGTCCGCGCGAAGCAAACATGTAGCCGTTAGCACTCGAGCAAAACTTCGAGTTACCAAACTTGC
GCTGGAGGGCAGGGTCCACGCAGAACGACTGTACTCCATTTAGGAATGCCTCCATCTTGGAAACAAAGTTGCGGATCACACCCATTGAGTGCACACGCGC
GTTCGGAATGTGTTGGGACTGTGAGTCCGGGTCCGGTAGGTCCAGAATCTCTTCCAGAAGATCAACAGCGGCAACACGCAGACTCGCAAGCTCACGCACG
TTGAATGACTTCAGGAAGCCACCGCTAGAGGCAATTTCCTCAAGCATGCGGAAACCGTCCACCACATCTGCATCATCGTTGCCAAACAGAGCGCTGATAA
CGTACATACTGGCAGTGAAGAACGAACGGATAGCCGATAGGCAGTCGTTCTCAACAAGCGTCACACGAAGCTGTGACTCACCCTTGCCATCCTTAGCAGT
CTTGATAGCCAGGCCCATCGCCTCGGTCAGCTTACCAGCTGACAGGAACACGGGCTCAAACACTTCGCCGGTGCTGCGAATATCGTACTGAAGAATAGCA
GCCTCCTTGTCATCCAGCAGATCACCCTCGCGGAACGAGTTCACAATCTCGTTCCACACCACAACGAAGCGCAGCATCATCTGAGACTCGTAAGCTGCAG
CCAAAGCGCTAGCACGAGTAGAGTCCGTGCCACTAGCAGTAGCATCGCTCGAGCGCGCTAGAAGCGTCACCACCTTCTGGTCGAATAGCTGAGGAGCGAC
ACGGAAAGCCTTGGTCATTTCCTTGGCTCCACGGATTTCACCTGTCTTCATGAGAATACCCTGGAATCCACCCAGCAGTGCCTGGAAGATCGTGAAGTAA
ATCTGCGTGGCGTAGTTGAAAATGAACACCACAGGCAGCCAGAGGGCAATGATAATACCAATGTTGTGGAACGACACCAGCGAGTTCTGGTAGTCCAAAG
TCATGGCGTAAATGCTCAACGTCGGCAACATCAGTGGACGCACCAGAATAAAGTACGATGCAATAGCCTCCACGATCCACAATAGGATCCAGAAAGCAAT
ATACTTGACCTGGAACGAGAACGGAGGCGTCATGTCTTGACCGACATAGCAACTCTCACCTTCACGAACAAATTTGGCTGCAAATGTGCCATTAATAACC
TGAGGCGCGAACGCCTGTGTGAGCAACACCAATAATCCTGGTAAAATGTACGCACCACAGAGTGGGTACAAATTATCCAGCAACGTCGTGTCTTTGTCTT
CATTCAGTGGCACGTAAATCATGATACCAAATAAAACAGCAAAACCACCGTTCCAGATGATACGAGTGGCAAGAGCAGAGCCGTATGTGAACGATCGAGA
ACTTGTTGCCGAACTCTCTTTTGAAATGAGCAAGTGCCATCCATGACACACTTCCATGACACATTTGAGGAACGCCATTAAACTCAAACTGAATGGAATT
GCAACAACTGCAAGTTTCAAGTCACGAGTTGTATAAGGGTCCACCACATCTCCAATGCGTCCGAATTGGACCCACCCACTTTTGCCACCATCAGGTGAAA
TGGTGACTGCAAAAGCCAAAACCGTGAGCAACACCAGAAACATCATGTTGAACTGGAAAATACGGTAATAGTTCAACACCATGGTCAGAAGACTTCGGTG
TTCGTAGAATGTTTTGCCATGGTTTTGCGTCAGTTCCTGACCCACTTGAGTCACGGAGATACTGAGACAATGTTGCTTCCAAAAGTACTCGTTGATATCG
TCATAATTGCGGATTTTGACGTGTTCCAGAGGTTTACCCAGTGCATTGCGACGTTTCATGTTGCTTGCTTCCCTCCAAATGGGTCGAATTACTTGGTCCA
AGTACCACCCTTCTTGTTGCCGTTCATGGCCTTGAGGGTCTGCATTCACCATCGTGAGCATCTGATGGAAAAGGTAACACAAACATTCGGGCATGTGACG
GACATTGGCAGATTCTCCCCAAATGAGAAAGTAAAGCATCACATCCATGTGCAAATTGCCAGAAGGTGTAGAATGCGGAATACCACTTCCCGTATACGTC
ACTGGTTGCGTGTGGATGAATTTGCACCATGACCGATAATTGCTCAACAGCTTATTGGCCAATTGGACGAGGTGTTGGTCCGCCGCGTCATTCGGCAAAC
AACGCGCTTTGCCATTTGCCAACAGAAGCAAAACATGTTCACGCTGGTTGCTCACCGAACCCTCTTGGAATCCGAATTTAGCCTTGAGAAATTCGCAACA
ATAGTCAATTGCCGCCTCGTCGTCTTGCGGTGCACCTTTGAAGCTCGAAGGCGTCACATCCATCGAATTGAGGCGCTTGCTGAAGCGCTCCGACCGCTCC
GACTTGTTACGACGTCGATCGGCGTCCAGCTCGAAGTAATTGGAGCTGGCGCGTCGACGTCGGTCCATTTCGCCGTGCCCCGAAGGTCCGCGCTGCGCCA
TCCTCTTAATTTCGGGTCTCCTTGCTTGTTTTCGGACCTGTTGCTAAGGAAATACCCGCGCGCGGGTCGAGTGGTGTTAACGCGACAGGGAGGTAGACGC
TGCCTTCCTCTCTTCGCTGGGGGTTTCCCGTTGTGACTGCGGCGCTCGATGGAGCGAAGGCTCACGTGCGAAAGAGGGAGAATGGAGGGGATAGGGCTTG
GGCTGGATAACTAGGCTTCAGTATGGAAACGGTCGCAAATATTCAGCGCAGCGGACAAAGACAGGCAAGGTTGATTTTCGACCAATCGAATGGACGGTAA
TGCGAGACAAGCCGCCTCAGTATCGGTTTTCCGCCCTCCATCTGCGCCCAAGCAACCCTGCATTCTGAAAGGATCAAACTGCGGTGGTCTATGACGCCAC
AAAGCACTGAAGTGGAGTCCCAGACAATGGCACCAGTGCTGTACTAGATCGGTATTCGTGTGGCTACATGTTCGATGATTTTGTCAATCGTGACAGGATT
GGCCAAAAGTGCATCTGCACGTCTGATTGGACGAAAATCCAACGGATTTTTTTGAGAAATTTGAGAATTGAGTGATGGCTTCTGGTTTCCGAGTATCCTG
GTTCATCGATAGTCTATTGCCAAATGGCATCCTCTTGCTGTCTCTCTCACAAAAACTCTGGTGTTGCTGCACATCTGCATCATTACACTTGCCAACTCTG
TCGCTACCATTGTTTAGTCCAAAGTTACTTGGCTGGCCTGGGATACCTCAGGAGTCTGCGAAATTCCGGCAATCTGCAACGATCCCAGCGATCGGTGCTT
GGCTCTCGATCGGCAGGGATAGTATGACCGCAAAGCTTGTGCACCGCAGTGACGAACCAAGCATGTGGGTTAGGAAATCTATTGACACGAATGAGTCGTG
TTGGCAATTTGAGGGTGCATGGAACGGAGGCCATGCCTCAGCTGCATGGTGCAGCCTGCATCTTATCCGTCGAGATTGGTCCGCTCTTTCAGCTTGATAC
ATTTGAGGCCGATTTCATTTTTCATCGCAAGAAACGAACTCGATGGCGACGTGCCCTTTGGTGCAGGACGGGCGACATACGAGCCTGTATATGTCGTTCG
GCCTCGCCACTTTACTATTGCGCTTGCGACTGTCGCCACCGTTGCAGGGTTCACACCAGTGCACGATCGTCTTGTATTGCGCTCTACGTGCAGGTGCTCG
AAACTGATATTTTGGAAATGGCTCGACATGGCCTATGAGCCAGTGCAGCAACGAGGTCTATTTTCAAGTGAAATACCTGATCTGCTCAGCTGTGTGGTGT
TGAACTTTACTATTGTAGTTACACTGGTGAATGATGCACCAGCGACCTACTACAGGCGTTTCGTGTCTGCAAATGTGCTGCAGCAGCTCAGATTCCCACC
TGTGGCAAATTAAAGATCGATCTGCTGCTAAAGCACTTGAAACACAATAGCTGATAGGACTGTTAACGTTATAAATAATAATCGTCAAGACGAACAGCTA
AAATAGCAGCATCTCGATGAGCTCAGCCTCTAGTATGCTTTCAATAAATCGTCTTGTGACACCTCACAACTTGTGATTTCATCAACTCCTGTTGCTCTGT
AGTTGCCATGGTTGCTATCTACTCTACCATATGTAAACACGATAATACCAAGACGCAAGCGAAATGGCTACATATTTCAACTTCAGTTGTACACAACTCC
TACACAATGCAGCAAAGAAACCAAGTGGTCTAGACAATATTAGCGCCAAACTGCTGCGCACGAAGCCATGCTTCTGCTTCTTGGCAGAGCTCGCGACCTT
CTTGTTGCCGCCCTTCTTGAACGCCATCATGTGCTACTGAAGGCAAATAGCCACCAGTCAACGAGAGCTCACGTTTTGACAAAAGAAGGTGGTGTCGAGG
ATAAAAGACGGTAGGTGAGGAGCATAGATGCGACGAAAAGACGTACGATGATGTAGCTGCAACTAGTGCAGCAGTTGCCAAGTACAGAATGATGCCTTCG
TTCGCTATAATAAGCTGTGATACGTAGGACATGATCGAGTCTTGTGGACAAGTGTCAACTTCCCAGGCCAGGACATCAGTCACACCGTTGATAGTGTTGA
TGTCGTAGCTAGCTAAGATGTAGTTGCCTAGTACTCTTATGGGCTGCAACTTCGGCTATCAATGGTGTTCGAAACGGATCGAGTCATTGACGTTGTATTC
CTTTGCTATCCGAGCGACCGATCTGATCAACGCCCCAAAGACTAAAGTTGTCATGCCAAAAGCTCAAGGTCGATCCAACCACCAGCGCTTACCAACTGAG
CTACCTTCTCACTCTTCAATTTGCGCGTCTTCAAGCACCAGACTACACCGAACCCACTCAAGAACTACTTCCATTGACGGCAATGGTCAAGCCCACAGTC
ATTGTTGTCGCTGTTGCGGTTGCAGCTGCAGTTCTTGTCGAAGGTAAATTTCATGGTGAACACCACGGACACCACCATGGACACCACCATGCACCTTCAG
ACGCAGGAAGCGTAGATCTGCCTTTCGACGGAAGCGACGACAAGGGTAAACCATGGTCGGGTAGTGGTTTTGGGGGTCATTTCCCAGGTCCTCAAGATGC
TGGTAATTCCGATGAAATGCCTCCATTCCACGACCGTGGGTCGTTCCATGACGACCACTACGGAAACGAAAAGCCTGACAACGAGCAACCTCCACCGCTG
GGACGCCAACTGAAGGCCACAGAAGGCGAGAAGGAGTTCGATGTACGCTCTCCTCGTTTCCATGGCAGTGACGATCATGGTTCATGGCACGGGAGCGGAA
GCTTTGACGGACATTTCCCTCACCCACCGAATGCAGGCAGCAATGGCAAACCCCCCGTTCCCAGAGGCGACCATGACGCTAAGCCTCCAAAGAATGGGGA
CAAACCGGCACCGATGTCAGATAATCGCACTGAAGAACTTCCGCCGCCAGAGGAGAATCTCCAGTAACCCAGCACAGCTCTCAATCGTGCGCAATGGACT
GATCACTGATCTGGTAAGCTGACAAAGCACCACATGTGCACCACCATCGCTGGCAACCACAGCCATTTATCAAATTCTATAATACCCACGCAACACGAAA
TATTCCATTGCATACAAATTACGCTGAGCTAGGCTCATTACCTGATAGATGTTGATGACTGCGCTAGGTGGTATTATTTGTATCACGTGACGTGATGGTA
CTTGAACTTCCGTTTTCTGCTTGGTTTTTGCTCGACAAACTGATTCAGTCTGTCAGTTGCAAAGTCTCCGTGTGAAGCACAAGTCGACTACCGAATATGC
GTACGCTCCGACTGCTTGTGGCATCAC