Description :
From Genome Similarity Track
Location :
Scaffold_897:9836- 11292
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_897-snap-gene-0.3Intraflagellar Transport Protein 140
Pytar_ATCC12531snap_masked-par_contig_897-abinit-gene-0.9Duf667-containing protein

Sequence
1456 bases(100 bases per row)
CCTGGCGGTGCGTCGGGGGCACCTGCGCGTTGTAGTCGTAGAAGAGCGCGCACATTGGCCACGAATAACACCGAGTGCGAGACGCACGAGGGGGNNNNNN
NNNNAGCCGCGTCTCTTCAAGATCGTGACTGATTCTGCGAATAGTGACGCGTGAACACTGACACAATGTTGGCTGCTGATATGAAAGGTGCTCAGTGCAC
TGAGTGCCTGTCGACTTCCCTCCTTATCCTGAGAATCCATTCGCCTTGNNNNNNNNNNCGCTGGTTGCTGATATGAAATGTGCTCAGTGCACTGAGTGTC
TGTCGACTTCCCTCCTCCTCCTGAGAATCCATTCGCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGGTGTCGCTGTACTGTTCGTCCTGGAAAAACACACGGAGCACGCGGCAGTGGCCTGTGATGCG
CAGCTGCAAGGTAGTCACGTGCTTTGCCCCAAAAGCGCGCCGCGTGAGGTCGTGAAGATCCATGCACATGTATCGCCAGCCGGGCTCTCGCCCCATGACC
ATCGGAAGCTGGCACGTGTCAGCGTCCACCTTGGCGAGCGACCGCGCGTTCGTGATCCTGAGCTGTCGGTAGCGCTGCTTGTCGTCCAGCACGTCCACCT
GGATCTCCACAAAGTGCTCCATGTCCTTTAAGAAAAGCACGACGTACTGGAAGACATTGCGACACGGAAACACCAGTTCGGCGTCTCGCCCCGTGAGCTG
CACGACTTCTTCTTTGACGTCTTCGTCTTCGACGATCGTTACGCTGTTGCCGTTCTGCAGAGTTGCGCATTCCTGTTGTGCGCGACGGACTGTAGGGTGG
TCTCGCAGTGGGAGCGCTTGGTCTCCGTCATCCTCGTCTTGACTCTGACCGACGTACATGCCACCTTGGGATGGCATAGCTGGAAGCCCACGTTTTGCGT
TGGATGAGAGAGAGGATGCTACAGATCGGAGACGGGGGAGCAGAGACTCTACGATGACGTCTCCAGGCGAGAAAGATCCATCGCCAATCTTCACAGAGGA
GAGAGAGGTCCTTGACGCCGACGAAGATATGGTACTCCGAGACATTGGCGGCGTGGTCGTGCGGTTGCTCATTTTTGGTTCTTGATCAGCACCTTCTTGG
ACGGAGTTTCGCCCTGTCGCGACCCGTCGCGATCTCTCAGTTTGTCGCCCTTTCGACTCGCACAACGACTTTCCGTGTCAAAACCTCCACTCGCGACGAT
GTCGAACTTCTTTCTTCAGCACAAAGATCTCTTCGAGTATGATAAGTTCGTCGGTGGCAGCGGCCACGTGACGTCCTCGACGCCATCGTTTCTTGATCGA
TACCGAGAATGTGATCGCCAGCAAGCAGCACCTGAAATGACACAACTTGCGACGAT