Description :
From Genome Similarity Track
Location :
Scaffold_74:98334- 101058
Sequence
2724 bases(100 bases per row)
AGTCTTAGGTTTAAGGAAAATCAACTCTGACTTTATTTTAGGACCAAGGCCACAGCCCTGGTCACTCAAATACACGTCATAGTCCAATTGGCTAATAATG
GGTCTGGCTCCCCATATATCAGCCAATGACATGACAGAAATTCAGCACACGCTAGTCGTGTGCTGATGCACCTACTTATGTAAAGAAATCTACCTACTTA
TGTAATTGAGGGGCGGTAAGACTACAGCTAATAAAAGGGTTTTTCGCGAAAGAAGTCAAAGCAATGTGTCATTTCAACTTAGGATATGTTATTCGTATGC
TGAACTCAACGTAGTACGTATTGAACATCTAGCGCGGGAGAGGTCTACCACGCGTATGCCTCAAGGGTAGGGCCACCGTTCGTGTCGGGTAGAGCTGAGG
GGTGATGTTCCACGTATCGTACTGGTAATTACCCGGAAGCTGCGTCTCCCATGTCTCGGGTTTTACTCCCACCGCACCCGCACTTCAAATCTGGTTGGGG
ATGTAAGGATTTACCACAACACCCGAGGGATAGCGTATCGGACCGCAATTGAAATGATCCGGGATAGCTAAGGGTAGTGCCGGTAAACCTCCCAGCAATG
TCATCTGAGCCCGCTGTACATTGGCACCAAATACTTGATCCGACCCACCCTGATCTTGTGCATTTCGTCGAATCCGATGATCTTTAAATTTTAGTTGGTA
TCCGTTGACGCCAGAAACGCTGAGACCGTACGCAGCGCGCCCGCAAATAATGTGCGCGCAAGACAAAATCTTTTTATAGTAGTAGCAGGAGCACTGGTGG
AGTCGATTCGCACCACCCACCCCTCTCTGGGCATAGCAACGTGGTGGGCCCGACGCACTGACCACTTAACAGCAGTCCTGTAAAAGCTCGCCGCCTTTTG
TTTTTCCTCATCTTGAAGGCACTCGGGGGAAAGTAACGACCCGAGACGCTCACCGCTCAGAGGAATGTCGCCTGAAAGCGACGAGACGTCATTCGCCTCT
GTAGGGATCTCTGGATCATTGCCCAGATATAAAACGCGTACCGCCGAAGGCGTGAGCGTAGCGTAGATAGCCACTCGACACGTTGAGACCAATACTTTTG
CCAATCGTGTAGGCTCCTTGGGCGGTGTAATTCGATCGCCCGCTACAGATGTGGGAAGGCATATAGTGTAGTCGTCCGATATCGTCAGAAGTTTTTTTAG
CAACCTCCTTGTGTCACACGCCTTGCGTTGTGTGTGACTCTTTATGCTTGCGTTGAAAACCTCACAGGGATTGTTCATAGTTGCAAAAGCCCCCGGCTAA
TGAAAAATCTGCCACCGCCAGAAGCGACTAGCGACCCATTGACTGTAGAAATAGTTCGTGAAAGTTTCTAGTCTTCCGTCCAGAAGCCATTCCTGAGAAA
TGCGATTCCACTCCAGATAGCGATGGTCCCTGCTAAGCGTGTAGTGCATATCTAGAACTCCGCGGTACACAACAGCTCCAAGGGCTTCGACAAGGTGCTG
GATACGCTTTCGTACGTTGTATAGTACGTGGAAAAAGCACATCAGGTAAATGCTGTTCTCAAACTCACTGATAGCAACTAGCCCATTAACCTGAGCCTTC
TCCGCGTCTTCCATCACAGCATTGATACGCAGTGCTACACCCAACCGCTCCCAAATAACCCTGACGAAACTACGAACAGCCTCATAGTACTCACGCTCAG
TTCGCTGGCTCACAATAAATATACTAGCTAGGTGGTAGATTCTTCGCCGGTCAGTAAAGCCACAGGTAATAGCTGGATACCCCAGGTCACTGAGTTTGAA
AGTTGCATCCAGGTGAAAAATCATAAAGTTCTCCTTCTGCTGTAGCGCCAGAATAGCTTGCATGAGTTTCAGACTGGCTATACCCAAAAATAAAGGTTCA
TCGTCCTCGCCATTACCCACAATCAGGAATTCACTTTCGTCCTGTCGAATTTCAAAACCGAACGCCGACTATGGGTCAAGATTGGCCCTGAATGCTTCGA
AATGACCAGCTCGCGTGACTTGAGCATTGAGTTCTTCGACCCGTACAGAAATCGATTGTAACGAACGTTTCGCTGGACCTGAGCGCATGATGGAAATCCA
AGCGCTGGGGACGGAAGGTCCGGTGCTCGCAGAAGCTTACTCCATATTAAGCGTGGTGGTATTGCGCTCTCATCCATGCGTTGGAAGTACTCCCGCATTT
CAGGAGTAACGCGTGGGGGTGGCCCTACAGCACACGGCGTATCGCCTGGTAAATGCTTCTCAGTGCTCTCGAGGACGACCCACGTCGACGAGATTTCGCA
GTGTTGAACTTTCCAATGCACTACTCACTTCTTCGGCAACCCGATCCTGCGCAAGTCGGACTCTTACATTGCAGGCGGCGCTCGGCCATTTCGTGGACGC
CTGCGCAAATGCTGCACCATTTTGTTCTCACTAAAAAAATGGTCGAGCAGCAAAAATGATCCCATCGGTACTTGACGAAGTCGGACTCGACATGCAGCTC
GGCACGCTTGGTCCAGATGAGTTTGGGGGGAATCGTGCAGACGTTTGGGTGGTGGTCCGGTAGGAGCGTATCTGACCCTTGAGGCTGAGGTTCAGAATTA
TTGGCCAGACGGAGTTGTAGAGACAAATTCAGCGTAAGCGGGCTTAAGGTTTTTTTATAATCCTACATATTTGGTCTTGAGCACAAATAAAAGTTGTGCT
TATGTAACGGGGTACAATCCACTG