Description :
From Genome Similarity Track
Location :
Scaffold_676:9832- 11392
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_676-snap-gene-0.5Gene of unknown function
Pytar_ATCC12531maker-par_contig_676-snap-gene-0.3Major Facilitator Superfamily (MFS)
Pytar_ATCC12531maker-par_contig_676-snap-gene-0.4Gene of unknown function

Sequence
1560 bases(100 bases per row)
GATGCTGCTGCGCCCCGTGACGGCGTGCTCAATGTGCACGCGACGTACCTCTTTACGTTCTTCTACTGGGCGGCGAGAAGGTGCGTCGCCTCTCTTCTTC
CGCTCCCATCCGAACTGTAACCTATGTGGTTCTTCTGTCTCCAGCATTCTGTTCCAACAAGTCATTGCGGGCTTTGTGTTTGTGCTTACGAATTCGAACC
AGCCCGTGGGCATTGTCAAGGGCGTGCAGGGCATCTCGCAGCTCGTGTTCTCGTTTCCGGCGGGATACATTGCCGACCACACGCGCCGCGACCGCGTGCT
GCACCTCTCGAGTGTGCTGGGACTCGCGGGTGCACTACTCACGGCGATTGCCGTGTGGGAATGCAACTTGCTGATGCTCAATGCGGCGTTCGCCATGTGG
GGGCTCTTTGATGCGTTCCAGTCGCCGGCGATGGAGGCGCTCTTTGCCGAGTCCATCCCGCACGGCCGCCGCTCGTACCCGTTTATGATCAAGTACAACG
TGAGCAACGTCGCCATGGTCGTGGGGCCGCTCTTGAGTGTGCTCCTGTTCTGGTACTTTGGTGACAACTGGCGCGTGAGTGAACTGCAGCCCGTGCTCTT
GAGCGGGTGCCTGCTCGTGGCCGTGGCATCGCTCGTGCTCTTTCGGTTCAACGACGACCACACGCTGGGCGACGAGGAAGACGAAGAAGAAGTGGACGAC
GAAGATAACGTCAGCCAGCTTTCCATCAACCCCGGCGCTGCTGCCGTGCGACCGAGGAGCTACTCACACCGCAGTGGACACAGTGAGGCCCTGCGGACTC
CGTCAGTCGTGGGGAACGACCTGGAGATCGAGTACGACTATTCTGATGAGGAAGAAGAGGAGACGGAGCCACCCACCGAGACCAGTGCGCTCATGGGGTC
CAAAGGATCCACAGGCCTCCACGTCAAGCTCAAAACCTCGCCAACGCCTGAGCCAAAGTTCTTGTTCTTGCGCACGCACCACGTGCCGTGGCTCATCTTC
CTCTCGGACTTTATCATCAGCAACGGCGCCGGCATGACGATCTACTTCTTCCCACTCTTCTTCAAGGAAGAGTACGGGCTATCGCCCATCCACGTGAGCC
TGCTCTTCATGGTGCAGCCGCTTCTTGTGGCCGTGCTCTCACTCGTGGCCCAGCAGCTCTCGACCACGCTCGGCCGCATGCCCGTGATTGTGACCACACG
CGGCCTCTCGACGATCTGTCTCCTGGGTATGGTCTTTGCACAGCCGCTGTGGGTCCAGATCACGCTGTTCCTTCTCCGCGGAGGCACCATGCGCTGCTCG
CAGCCGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTCATGGACTTTGTCCACAAGGACGTGCGCGCGCGCTGGAACGCGCTCGAGGGCG
TCTCAGTCTTCTCCTTCTCGGGCAGCGCCGTGCTGGGCGGGTACCTCGTGGACGCGTACGACTACCGCACGTGCTTCCTGGTCACGAGCCTTGTCTACAT
GGCGGGCGTCTCCATCGAGCTCTTCTTGCTGCCGCTCACCAAGCACGCCATCGAAACGTA