Description :
From Genome Similarity Track
Location :
scaffold_47:98318- 99324
Transcript NameFunction/comments
g2046.t1 hypothetical protein PHYSODRAFT_288743
g2047.t1 pre-mRNA-splicing factor ini1

Sequence
1006 bases(100 bases per row)
TCGTGGCCTTGATCTCCTCACGCTTCTCCATGGAGAACAGGATGTACGGAGACTTGCCGCGCTTGGGGGCTCCCGGCGCCTTCTTCTGCAGACGCTTGCG
CTTCTTGCCGCCGGTTGCCTCAGTCTTGATGGCCGCCCAGGCAGGCCCAGCTACATGTTCATTCGCCGCAAGTGGTTCCATGCTGGTAGAGCGTGCAGAA
GGCTTGACTTCGCTTGAGTATGCCGTATAGTCAGCGCAGGCAAAAGGGAGAATGCGGATCTCACTATACCATACAAATTCCTTGAGAACCGGCTCGATGT
GTGACGTTTTTCACTGGATTAAACTATTTGAAATAGGCGTCGCCCACCCTCGGAGGCACTATCATCCCTCCTTTCCGCCACTTCAGATTACAGCCAATCA
GGGTGCAGCAGATGAAAAGTAATCGGGAAGTACGCTTTGAAGAACGCGTAAACTGGCACTGCAAGCGCCTTAATGAACGGATCAAGTGTTGCTATCCCTT
CCAGAAAGAGAGAGGCATGTAATCTACCATTAGACAGAAGGCTTACTACGTGCCAGGAGCAGTACTTCTCGGGGATCATTTTCATTGGTGAATTTGCTTC
AAGACCTTACCCTTGCGTTTAAACAGATATGTCCGGCATTCAGCAGCACATAAGTAGTCGTTATCGCAGATCAGTGACATCTCTGGGCAAGATAAGGAGG
ACAGAGCAATCTTGGGAAAAGGCGCGAAATATCCCACCAATCAGCAGTAAGGACTATCCAATAGACTATGATATGCCTTTTCTAAACTGTTTCGTGTGCA
TATTGTGTAACAGAGCGAACACTGCGGAAAAGCAACCAAGCCGAGCAGCCATGGCGAAGCACCACCCAGACTTGGTCATGTGCCGCAAGCAGCCGGGCGT
GGCCATCGGCCGCCTGTGCGAAAAAGACGACGGCAAGTGTGTGATCTGCGACTCGTACGTGCGTCCGTGCACGCTGGTGCGCATCTGCGACGAGTGCAAC
TACGGC