Description :
From Genome Similarity Track
Location :
contig_119:98294- 100020
Transcript NameFunction/comments
g11348.t1reverse transcriptase

Sequence
1726 bases(100 bases per row)
CCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCG
TGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACA
AGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGAT
GCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGT
TCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAA
GAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGG
GCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGT
GTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCC
TACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCG
CAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGG
TGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGT
GGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGA
GTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGT
GGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGT
GCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGAT
GCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACA
ATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGA
TGCCCCGACATCGGGACATCCTGGCC