Description :
From Genome Similarity Track
Location :
contig_54:98271- 99678
Transcript NameFunction/comments
g10767.t1XP_009515075.1 hypothetical protein PHYSODRAFT_472847 [Phytophthora sojae

Sequence
1407 bases(100 bases per row)
GGCCGCCGCGCTCCAGATCAAGCCCAATCGCATCCTCTACACGAGCGTGCTACTCGCGCTGCTGCAGCCCTTCCAGAGCGGATGGTCCACCTCGCAACTC
AACCTGTCCGACTACAACAACACGGAAGAGTGCAATGCTCGACCCGTCGTCCCGGGCACATGCACGCTCTTCTCCGGACACTCCAAGCTCGAGTGGACTT
TCGCCGTGAACTCGTGGATCTTCGGCGCCATGGTCGGCAGTCTGCTATGCGGCTACTTCAGCGACATGATGGGCCGCAAGAAGCTGCTCTTTTTCAACTG
CTTCTTCATGATCGGCGGCGCCGTCATCCAGGCGTCCGTCTCCAATGTGTGGCCATTCGCCGTCGGCCGCGCAGTCTCCGGTATCGCCTCGGGTGCCGCC
ACCGGCACCATCGGCGCGTACGTGAACGAGCTGTCGCCGCCGCACCTACGCAGCCACCTGGGCCTCGGCCTGCAGATCTCCACGACTATCGGCATCTTGG
TGCCGGCCATTTGTTTCTTCTTCGCTGACAGCGGCGATGGATGGCGCTACATGGCCGGTTTCCCCATCGTGCTGGCCGTCATCTTCATGCTGCTGTCGCC
GTCGCTGTCCGTTGAGAGCCCCGCGTGGCTGCTCATGAAGAACCGCCGCGAGGAGGCCAAGCAGGTCATCACGCGTCTATATGGCGAGGAGCATGTGCAC
ACGGCGCTGGGCTGGCTCGAGGCGTCCAAGCAGCTGGGCGAGGCGGAGGCGGGCTACTCCACCAACACGGAGCCGGCCGAGTCCGTGCTTTCGCCCAAGT
ACCGTATGCAGTTCCTGGGCGCACTCCTTCTGTCGTGCACGCAGCAGCTCTCGGGTATCAACGCCGTGTTTTACTACTCGGGCGACATCTTCTCGGACGC
CGGTATCGACGACTCGCGCATCGGCACGCTCATCATCGACTTCATCAACATCTGGCCCGCCTTCTTCACGGGCGTGCTGGCCACGCGCTTCGGCAACCGC
AACATGATCCTCTGGGGCATCGCCGGCATGGTCGTCATGTCCATCGGCATGACGGTCGCCTTCCTCGTGGACGTCTCGGAGCTCTCCATCGTCTTCACGG
CGCTGTACGTCATCGTCTTCGGCGTCACGCTCGGTCCGCTCGTCTGGGTCATGACGGCCGACATGTTCCCGGACTCGGTGCGTGCCAGCGCGTCCTCCAT
TTGCATCGGCGCCAATTGGCTCTGCAACCTCATCGTCGGCGTCGGCTACCCGTACCTGGCGGACGAGCTGGACGACTGGAGCTACGCGCCCTTCACGGTC
TTCCTCATCATCTTCTACTTCCTCTCGCTCAAGCTCGTGCCGGAGACGGCTGGCAAGACCAACGAGGAGATCCAGGCGGAGTACGAGGAGCGTCGCCGTC
GCTGAGG