Description :
From Genome Similarity Track
Location :
Scaffold_363:9827- 10970
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_363-fgenesh-gene-0.2Phosphatidylinositide phosphatase SAC1

Sequence
1143 bases(100 bases per row)
CGGCGACCTCGACATCATCAGCGATCTCGCAGCTTTTCTCGGAGCCCATCGCGTACGTCTGGTTTGACTTCCACCACGAATGCCGCAAGATGCAGTGGGG
CAACCTGTCGAAGCTCGTGACGGAAGTGAACGACCAATTCAACCAGTACGGCTGGTTCGAGTGCGACGGCGAAGGCCGCATGACGAACCGCCAGAAGGGC
GTCTTCCGCGTCAACTGCATGGACAACCTCGATCGCACGAACGTCGTGATGAGTCTCTTTGCGCGCCGGTGCACGCTGCAGTTGCTCGGCCTCCACGACG
AGGGTAAGGCGACAGCGAACGTGCTCGACTCGCCCTACGACGCCTTTGAGCTCGTATTCAAAAACGCATGGGCCGACAACGCCGACTACGTGAGCAAGAT
GTACGCANNNNNNNNNNGCGCACTCAAAACCGACTTCACGCGCACGGGCAAGCGCACGATCTCCGGCGCGTGTCAAAATTTCTTGTGCCACTTTGGCAAC
ACAGGGAAAAAAGGAAAGTGAGATGTCTGTGGAGAATGCGGAAAGCACAAGTTGAAGTAAACATCACTCTTGCTTTACCTCTCCATGTTGAACCATCATT
CCGACATGGCGGATCAATCGGACCCCTGTTGGTCAAAAGAGGATCACATCAAAACCACAAGTCAATCTGAATTTGGTGTGCAAAACACCAATTAATAGAC
TGATTTGATTGGCGAACAAATAATAACTACAGTTGGTCCAATAAGTCACNNNNNNNNNNATCCAGGACGGCGTCAACTCGGTCACGCGCTACTACCTCAA
CAACTTCTCGGACGGCGTACGCCAGGACTCGTACGACCTATTGGTGGGCAACTACGTGCCGGACAAGCGCGACGAGAGCCCGTTTACGTTCCAGCAGCAG
CACAGCCTCGTGGCTTTTATGGCCGAGCTGAGCCTCGTGAGCCTCGTGATCATCAGCGTTTCGGTGAGCATGCGTCCCGAGGAGGAGTTCGCCACGCGCG
TGCGCGACGGCGCGGTCGCGTCGCTCGTGCTCTTTTGCGCCACAGGGTACCTGATCCTCAAGAAGGGCATCCTGCGGTCGCTCGGACGGCGCTACGTGTG
CAAACCCGCGTTCTGCTCGAGCGGGTACATCAAGCGAAAAGAC