Description :
From Genome Similarity Track
Location :
scaffold_7:98253- 103960
Transcript NameFunction/comments
Pl_112723hypothetical protein PHYSODRAFT_351681
Pl_112724Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, putative

Sequence
5707 bases(100 bases per row)
CTTGGTGATCAAGTTGACTAGCTCATGCCGCTTTACCAAGCAGAAATGTTCCAAACAAAACTAATCGCTGTGTTGTTCATGTCGTAGGAGTGTTCTGGAA
TCCCTCAATTTGGCGTAATTTAATGCGATCGAGGCTTCATCAATGCCATAACAGGTAATGCAACGCAGAGTGCGAGCAATCTAGTGCTCCAGGTTCTTAT
GACTGATCAGAAAATGCAGCATCTCTGGTAAAGAGCATTCAGCAAAGGCTCTTCATTGCTTTTACAGGGCACATTGCCACGGGGCAGTCGTCGCCCAGCG
ATCTTGCTGAACCACTTCAATTCCGCAGTCGTTGCATCGTTGCGACAGCGCCGCTCGCTAGGCCGGACCAAAAACGCGGCGTGGCGCACACAGCACCACC
CGATCTGGACAGAGAGAGCGGAAGATGCCCATTACCTACGACGTCTCGACAGGTGAGGCAGTCGGTCTCCACAACGGCCTCCTTCATGATGTAGATCGAG
TTCTACCATCGAGACTTGAGCTGGATGATGCCAGCAGCAGCTTCCTTGTATACATTCACCCACAGCTCTACCTTGGTTGGATAGTGGGGATCCTGAGCTA
CGAGTATCTTGGTTTTACTATTGAAAGACCCCTACCCCGCTCTCAGGCGGAGTGATGGTCGCCTTCCATCGTCGATCGCAAAAGGGAAAACGCGGCGGTG
GTCGGCGCAGACCAGAGAAGCAGCTCGAGGACGCAGTGTCGTCGTGAAGCAAGTCCGCGCAAGGAGCAGTAGACGTCCGTCACCGACGCAGAGAGCGACT
CGCAGTGGCCCCGCGATCCCAACGCTCGGCGTGAACTCGCCTGCTAAGTACGCACGCTCCCTCTCCCCCTCCTAGATCCCTCTCACTTGGGATATTCCTA
GCCAGCTGCTAGGGTTTACAGCATACTAAGTATCTAACGGAACGCTCGCTGTCTGCTCCTAGATAGGTTAAGCGCTAGTATCTCAACCCAAGATGGCGTG
GACCTGCACAGCGTGTGAGTTCGCAGCCAATGAGGACGGCCAAGATGCCTGTGTGGCCTGTGGCTCCGAGAGACCTGAGGAGGAGCAGCAGCAAGAGGAG
GCGGCCGAGGCGAAACCAGCTGAAGAGAACGGAGATGACTCGGGCCCCGAGGTCGTTGTCATTGAACTCCCTGCTAAAGAGAAGCTCGGCGTGAAGCTCA
TGCCTCCTAAAGACGGCGTGATCGACCATGGCTTAGCTATTGATAACATTAACAACCCATTGCTGGAGAACAAGGTGCAGGCAGGTGATCTGATTGTGGC
TATTGGCGGACAGAACGTCGATGGCATGGGGTTCTCGGATGCTATTGATCTGATTCGTAAAATGCCTCGACCATTGGCAATTTCTTTTGAAATTGATGAA
GTACGACGTCAGGAGGTTGTGAGAGAGAAGTTCCAACAGAATAAGGATAATGATCTGGACACACAGCTTACAACGTATGCTGTTGTGTTCGACAATGGCC
CGATGGGATTGAACTTGGAAGAAGCTGTGCGGTACGGTATTGACGGTGCTGTGGTGCGCGCCCTGAAGGGTCAAGCCAAGACGAGCGGTATGATTTCTAT
CGGTGATATTGTGTACAAGGTGAACGAGACAGACGTGTTGTGCATGCCGTATCTTGAGGTCATGAACGTGCTTCGTAACGCGACGGCTCCGAAGACTCTG
CAGTTTGTGCCTAAGGACAAGCTGGCTGATGTGCAGCGCGTGAACTCACGACACTCTGAGTCGTTCCGGCTGCGTGAGTCGACATCGCACGTTAAGCAAA
AACTCATGAACAACCCGCGCATTGTGAAGGATGATGGCAACGATGGCGACGATAACCAGTCAATCGCGCAACTGATTCTGGATAACCAAGCAGCAACTAT
CAAGAAGGGGCGTATGTACAAGCAAGGACGTGTGATGCGCAACTGGAAGTCGCGATATTTCGTGCTGAGTGTGTCGAAAGTGGAATATTTTAAGAGCCCA
AGTTCTACAACTTCGCGCGGTGAAATGAGCTTTTTGAATCATCGATGCACAGTTCGTTCACTACCTGGAACGGGTGATGTGGTTTGTAGATCTCCAAACG
TGACTGCAGAGTATTTGCTGGAGCTTCGTGTGGATGACCGTCGAATGGTGATGGCATGCACGTCCGAATCGGACAAAAAGGGGTGGATGGATGCAGTTAA
GCTGGCTATTGACGCTTCGAAGACTGTCAACCGCACACAAAACCTTGGAGAATCGCTACGAGAGGCCAAGGCGTTGCGAACACAGCGTACCGAGAGCCTT
TCAATGGATGGAACATTCTTGGACCGAAACGCTGGTGGACGTCTTTCGCAGTTCAATTACGAAGCTTTCTCAACACCTGTTGTGCACGTTGGTGTTCTGT
CGGCAACCAATTTGACGAAGTCGGGCAGCTCGGTGAACGCAATTTGTGAAGTTACAGTTGGCGCAGAGACCTTTAAGACGTCAGTGGTGAAGAACCAGCG
GTCACCTGTGTGGAAACAAGATAACTCAGCTTCATTCGAGGCACAAAGTGATGACATGGTGGTGGAGATTCGAATCTTTGACGAACACTTGTTCCGTGCG
ACGGAGCTTATTGCGACGCTTACGATTCCTCTGAAGTCGTTACCGAATATGCAGAAGACAACGAAGAAATACCCTCTTGCACTCGGCAGCCGTTCTGCTG
GAGCAGTGCTGACCTTATCGCTGGAATACGTGAACAAACAGAAGGCGTTCGAGGAGGACCAGGAGCGTGGTCGTCTTGGTGACGACCTGAACAGCAACGG
TATGATGAATGAGCGCGATGAAATGGTCAAGATTAAGGCTGAGGCTCAGATGGCCGCTGATGAGGCCACACACCACGCTGCTCGTGCACAGGAAGAAGCA
CACATGCTGCTTGAGCAATCTCGTCAGAAGGCAGAAGCAGCTATGGCTGCAGCTCGTGAAGAACAGCGCGAGGGCAAGGCTGCTGTGGAGAAGGCCATGG
CGGAAGCAGCCCGAGCAAAGGAGGAGGCAGAGAAGCAACTTGCTGAAGCCCGACGGGCGCAGGAAGAAGCTCAAAAGCTAATTGAGGCAAACCGCCGTAT
CCAGGAGTCAGATGTCCAGGGACCATCGATTTACGCCGCGTACAGGCGTATGGTTCAGGATGGACACTCTAATGAAGATGTGAAGAAGAAAATGGAAGAA
GATGGCGTCGATCAGATGGGTATCCAAGCGTTCTTTGACGGTATCAATTCATACGACGAAAAGATCCGCGCTCTACAGGCCGAGGTGGAGAAGCTTAAGC
GGAGCCGTTCCGGGCGACAAAAAGAGGAGCCGAGAGCACAGGACATGCTGGCCAATCTGGATATTTCTAGTGACCAAGTCAAGCTGCTTCGTCGTTTGCT
GAAGCTGGAGAAGCAGTTGCAGCAAGCTGGTATTGCAGTGGCAGCAGATATTCCATATGAGGAAGCCATGGCTAAAGTGCAAGAAATCTCCAAGCGTATG
CAAGAAATTGGCTCTGCTGATGTGACGCACCCAGACCCCGCAATCCAGAAACAGCTTCGCGAAGAATACTACCGTCTTGAACAGGATATGGAGAAGTACA
ATACTGCTCTTATGTTGACCGACGAGTATGCCGCAGAAGAAGCGCGGAAGGAACGCGAATGGGAAGAAGAAAATTACGATGAAAACGTAAAGGCATTGAA
GGCAATCCGCCGGATGATGCCAGTTGATGTGAAGAAAATGTCGGAGGCTGACCTCCAGACTTCGAAATCACCCACGGGCAAAACACTTCCCCGTGATGTT
GCCCGTAAGTTCAAGCGAACAAACGTGCTAGAATTGATTCGAGTGGACCCAGCTGATATTGCGAAGAATCATCCGTCACTACTTGAAAACCTGCGCGTTA
CAGGTCTTACGGTGACAGAGCGTCGTGCACTGCACATGCACTTGCGTGACATTGCGGAGTCATGGAAAGCTCAACAGGGTGAAGAAATGACAAAGAAGAA
ATATGAGTGGTTTAAGACGCTCAAGGAAACTTTCAAAACCGTTGTGAACTCTTACAACAACCACGTAAAACAATATGGACCGGAGAACAATCACCCGTAC
GCCACTCGCGACGATCCAGACATTGGTTGCCCTATGATTGGCAAGCAATGCCCAATCAAGGCTAACAAAAATCCTGCATACGACCAGGACCTTGGATATC
CCGACGGTGATGTATACATGGAGTCCACAGTGCAAAAGGGTAACCCTGATGATGCTGGCGCGCGAGCTTTGGCAGAAGCACAGGAGCTAGCCCGAGCTAA
ACTTGCTAACTCCCGTGCGGACGCTTTGAAGAAGCACTACAAGAACGTGCGATTGGTTGCAGAAGCCAACGGTGCGTGCGAATTGATTGACACATCGTTG
GATCAAATCGAGAACCGGCAGCTGCTTTGGTTCCAAGCAAGACTTAAGCGCCGGCTTGAGCGCACGGAAACTGCTGCTACAATTAAGGTGGAGTTGGCAG
AGTTTGGTGAGTTAGTGAACGAAATTCGTTTGGCAAGCTTGAAGTTCGCAGAGCGATCAGGTATGAATCTGTCTGGAAAGCGGGACGCATCACTGGATGC
GAAGGATACACGTTCGTCTATTGAATGTAACCTGATCCTACTCTACTGCGATGCCGTGGTCGACTGCTTTGACGGCATGGACGAGCGCATGGATGAGGTG
AAGGCAAGCGACAAGCGTCTGCGTTCGGCTATCCCTGTCATTCGGGGCCTCCTGAAAGACTTAGGTGAAAAGAGTCGTAACACTTTGGACTCGCTGAAGG
ACAAGGGCCCGCCGGTGAACCGCCGCGTGAAGACGAGAACGGAAATCATGAAGGAAGCGAAGGAGAAGAACAAAAGTGCGGCAGCACCTGCAGAAAGTGA
AGCGGCGGAAGAAGCTGGCCCTGGCCCTGGTGGTCGGGCACCGCATCCAATGATGGCTGCAAGAGGTAGGGGACGTAGTGGTCGCGGTGGTGGCCGTGAT
GGTCTGTTCGCAGCGATCAAGGGACGGGGTGGTGGCGATGGTGATGGTCCTCCTGGACCACCTACTGACTTCCTCGCATCAATTCGTGGCCGTGGTCGCG
GCAAACCGGGTGGCCCTGGACGTGGCGATCTCTTTTCTGCGATCAAGGCTCGTGGGGGCGGCGGCGATGACGGAGGTGGTGGTGGCCGTGGCGGTGACTT
GATGTCAGCAATCCGTGGGCGTGGTCGAGGAGGAGGAGGGCCAGGTCGTGGTGATTTTTTGGCTGCTATTGCCGCACGGAAGAAGGAGTAGAGCTAGTCG
AGCCACTTGTGATAGAAAGGAAAGCGGGAGTAAAGCGAAAACTGATGGCGTCGTGGTTGGATTTCCACAGCTCGCAGAAGTGCGAAGTGCTGGTGCCTGT
AGCTAGTGAGGAGGGAAGCGTAAAACTTTTACGTTTCTCTCGTTTAACAACAGAATACAAAAAAGGAAAGTTGAAAGCGGTGGTGGTATTGCTGTGCTTG
CCTTCCATGTCTAATCATTGCGGAACTTCGGCTCCGTCTTGCTCATAACCGCGCTGACAGCCTGCACCAAGTCATCGCTATAAAGCACGGCAGCGTTGTG
GTAGCGGATCTGCTCGAGTGAATCCTTCGTCGTGTGATCCCGTTGATAATGGATCGTTTGCTTTATGCCACGAATTGTGAGCGGACTCTTCTTAGCAATA
GCCTTAG