Description :
From Genome Similarity Track
Location :
scaffold_178:9824- 16112
Transcript NameFunction/comments
g777.t1hypothetical protein
g778.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
6288 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTGGGTCTGGTTCCGATGA
CCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGGGGGGGGGGGGGGGGGGCGGGAAGACGCCCCGGGTTTGGTCAAC
CAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGGA
GGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCAC
CAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTT
GCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCT
AACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTT
GGACAAACCGAATTACGGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGC
CTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACA
GCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCG
GTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTC
GCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTC
GACATGGACAACTGCGTTCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTATAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCAT
GGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAAC
AAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAACACTCCGACGGAGTCGGTAGTGAT
TGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGA
AGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATC
ATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTG
GCCAGCTTCTGACGAGACCTGTCAGAAGGTGTGGAGAGGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGTCATCCAACA
AGGACGACGAGGGTGTAGTCATCCTGACGACGCCAACTGCGTTGGTGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGAC
ATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCC
GTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCT
TGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACACGATTGGTAGTAAACCACCTTCGTGATCGTGTTGCATCAGTGCGCATCCGATCGCGA
AATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTG
CTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTCGCCCGCGTAGTTGCTCACGTACTTGCACAAGTAC
GTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCT
TCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTTGCATGAGCTCAAGCAACTT
GCGGAGATGCTCTGTATGCATCTCCACGTCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCAAAATAACTCGGTGCGAAGTCGCGCACC
GAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTACTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGC
TTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATC
GATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTC
TTTACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGCCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCT
CACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAAT
GTCGTCCGGGAGTACATCCTTGTACTCAAGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGAC
TTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGA
TGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCAGCCTCATCTTC
TTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCT
CGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGT
GGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCA
CGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCC
TAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAAC
CAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCT
GATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCT
TCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACG
CTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGT
CGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTT
GCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGC
GCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCAT
AGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGG
ACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCA
ATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGT
CGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTTATAATTGCCCTGTTGCAGATCGAGGAACTCCGCCCT
CGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGTGTCCG
TACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGGACGCAACCTTCGACAACGGGTCGACGATACGCCGAGCCGCAATGGCAGTGTCGACCT
CGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGA
AGTTCGAGCAGCGGATTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCC
GCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTG
GGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTG
CTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCATAGGAGTAATTTACTTAAGTTTAGTATA
CTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAA
AACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAACGTGTTACTTTCTACCAGT
CATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG